ID: 948295135

View in Genome Browser
Species Human (GRCh38)
Location 2:236855157-236855179
Sequence TGGGAGAAGGAGGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948295135_948295148 15 Left 948295135 2:236855157-236855179 CCTGCCTCATCCTCCTTCTCCCA No data
Right 948295148 2:236855195-236855217 CTATTGACCCAAGATGTTTAGGG No data
948295135_948295147 14 Left 948295135 2:236855157-236855179 CCTGCCTCATCCTCCTTCTCCCA No data
Right 948295147 2:236855194-236855216 TCTATTGACCCAAGATGTTTAGG No data
948295135_948295149 16 Left 948295135 2:236855157-236855179 CCTGCCTCATCCTCCTTCTCCCA No data
Right 948295149 2:236855196-236855218 TATTGACCCAAGATGTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948295135 Original CRISPR TGGGAGAAGGAGGATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr