ID: 948297145

View in Genome Browser
Species Human (GRCh38)
Location 2:236869301-236869323
Sequence TCACTCCAGTTTCAAACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948297145_948297147 17 Left 948297145 2:236869301-236869323 CCTCAAGTTTGAAACTGGAGTGA No data
Right 948297147 2:236869341-236869363 GGTTCTCTAGAAATGTGAGCAGG No data
948297145_948297146 -4 Left 948297145 2:236869301-236869323 CCTCAAGTTTGAAACTGGAGTGA No data
Right 948297146 2:236869320-236869342 GTGACTTCTTTGTTTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948297145 Original CRISPR TCACTCCAGTTTCAAACTTG AGG (reversed) Intergenic
No off target data available for this crispr