ID: 948298805

View in Genome Browser
Species Human (GRCh38)
Location 2:236886433-236886455
Sequence CTGTTTGCACTGACTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948298802_948298805 -1 Left 948298802 2:236886411-236886433 CCGACTGAGCTGAACAGTCTACC No data
Right 948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948298805 Original CRISPR CTGTTTGCACTGACTGTGGC TGG Intergenic
No off target data available for this crispr