ID: 948301168

View in Genome Browser
Species Human (GRCh38)
Location 2:236908613-236908635
Sequence CTGTGTGGCTGGAGGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948301168_948301179 28 Left 948301168 2:236908613-236908635 CCGCCTTCCCTCCAGCCACACAG No data
Right 948301179 2:236908664-236908686 CGACTCAGCACAGTCCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948301168 Original CRISPR CTGTGTGGCTGGAGGGAAGG CGG (reversed) Intergenic
No off target data available for this crispr