ID: 948302093

View in Genome Browser
Species Human (GRCh38)
Location 2:236915084-236915106
Sequence GGCCTTGACCTGACCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948302082_948302093 29 Left 948302082 2:236915032-236915054 CCAGGGCAGGACTGCAGCCGAGG No data
Right 948302093 2:236915084-236915106 GGCCTTGACCTGACCATGGGAGG No data
948302086_948302093 12 Left 948302086 2:236915049-236915071 CCGAGGGAGTGGTAAGTGAGAAG No data
Right 948302093 2:236915084-236915106 GGCCTTGACCTGACCATGGGAGG No data
948302081_948302093 30 Left 948302081 2:236915031-236915053 CCCAGGGCAGGACTGCAGCCGAG No data
Right 948302093 2:236915084-236915106 GGCCTTGACCTGACCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948302093 Original CRISPR GGCCTTGACCTGACCATGGG AGG Intergenic
No off target data available for this crispr