ID: 948303765

View in Genome Browser
Species Human (GRCh38)
Location 2:236931265-236931287
Sequence CTACTATGCCTGGAAACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948303765_948303770 22 Left 948303765 2:236931265-236931287 CCAGTTGTTTCCAGGCATAGTAG No data
Right 948303770 2:236931310-236931332 TGAATGGAGAGGTGGCTAAATGG No data
948303765_948303769 14 Left 948303765 2:236931265-236931287 CCAGTTGTTTCCAGGCATAGTAG No data
Right 948303769 2:236931302-236931324 TACTTGTTTGAATGGAGAGGTGG No data
948303765_948303768 11 Left 948303765 2:236931265-236931287 CCAGTTGTTTCCAGGCATAGTAG No data
Right 948303768 2:236931299-236931321 ACTTACTTGTTTGAATGGAGAGG No data
948303765_948303767 6 Left 948303765 2:236931265-236931287 CCAGTTGTTTCCAGGCATAGTAG No data
Right 948303767 2:236931294-236931316 TAAAAACTTACTTGTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948303765 Original CRISPR CTACTATGCCTGGAAACAAC TGG (reversed) Intergenic
No off target data available for this crispr