ID: 948307265

View in Genome Browser
Species Human (GRCh38)
Location 2:236957646-236957668
Sequence CACCTCTAAATGATGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948307264_948307265 15 Left 948307264 2:236957608-236957630 CCTAGTAGCTTCTTTATCTGTTA No data
Right 948307265 2:236957646-236957668 CACCTCTAAATGATGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948307265 Original CRISPR CACCTCTAAATGATGTTTTG AGG Intergenic
No off target data available for this crispr