ID: 948307980 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:236963865-236963887 |
| Sequence | CTGCATTCTCAGCTAAGGCG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948307976_948307980 | 0 | Left | 948307976 | 2:236963842-236963864 | CCACAATGCATCTTAATTCCCAT | No data | ||
| Right | 948307980 | 2:236963865-236963887 | CTGCATTCTCAGCTAAGGCGAGG | No data | ||||
| 948307975_948307980 | 25 | Left | 948307975 | 2:236963817-236963839 | CCACATTTATGTTTTCTTTGTAT | No data | ||
| Right | 948307980 | 2:236963865-236963887 | CTGCATTCTCAGCTAAGGCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948307980 | Original CRISPR | CTGCATTCTCAGCTAAGGCG AGG | Intergenic | ||
| No off target data available for this crispr | |||||