ID: 948307980

View in Genome Browser
Species Human (GRCh38)
Location 2:236963865-236963887
Sequence CTGCATTCTCAGCTAAGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948307976_948307980 0 Left 948307976 2:236963842-236963864 CCACAATGCATCTTAATTCCCAT No data
Right 948307980 2:236963865-236963887 CTGCATTCTCAGCTAAGGCGAGG No data
948307975_948307980 25 Left 948307975 2:236963817-236963839 CCACATTTATGTTTTCTTTGTAT No data
Right 948307980 2:236963865-236963887 CTGCATTCTCAGCTAAGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948307980 Original CRISPR CTGCATTCTCAGCTAAGGCG AGG Intergenic
No off target data available for this crispr