ID: 948308823

View in Genome Browser
Species Human (GRCh38)
Location 2:236969969-236969991
Sequence TAACCACAGACGAGGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948308821_948308823 5 Left 948308821 2:236969941-236969963 CCGTTCTTTACAACTACACTTAG No data
Right 948308823 2:236969969-236969991 TAACCACAGACGAGGTCCTCAGG No data
948308819_948308823 12 Left 948308819 2:236969934-236969956 CCATCCTCCGTTCTTTACAACTA No data
Right 948308823 2:236969969-236969991 TAACCACAGACGAGGTCCTCAGG No data
948308820_948308823 8 Left 948308820 2:236969938-236969960 CCTCCGTTCTTTACAACTACACT No data
Right 948308823 2:236969969-236969991 TAACCACAGACGAGGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948308823 Original CRISPR TAACCACAGACGAGGTCCTC AGG Intergenic
No off target data available for this crispr