ID: 948309427

View in Genome Browser
Species Human (GRCh38)
Location 2:236973990-236974012
Sequence CAGTGAGGCTAGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948309427_948309435 9 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309435 2:236974022-236974044 CTTTGCTCATTCTTGGGCGTGGG No data
948309427_948309432 2 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309432 2:236974015-236974037 TGGATGTCTTTGCTCATTCTTGG No data
948309427_948309436 23 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309436 2:236974036-236974058 GGGCGTGGGCCAAACTAATTTGG No data
948309427_948309433 3 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309433 2:236974016-236974038 GGATGTCTTTGCTCATTCTTGGG No data
948309427_948309437 24 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309437 2:236974037-236974059 GGCGTGGGCCAAACTAATTTGGG No data
948309427_948309434 8 Left 948309427 2:236973990-236974012 CCATCTTGCCTCTAGCCTCACTG No data
Right 948309434 2:236974021-236974043 TCTTTGCTCATTCTTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948309427 Original CRISPR CAGTGAGGCTAGAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr