ID: 948312700

View in Genome Browser
Species Human (GRCh38)
Location 2:237000599-237000621
Sequence TAAGGTAATACAGGGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948312700_948312706 9 Left 948312700 2:237000599-237000621 CCCTCAATCCCTGTATTACCTTA No data
Right 948312706 2:237000631-237000653 CCTTCTCCAGCACACACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948312700 Original CRISPR TAAGGTAATACAGGGATTGA GGG (reversed) Intergenic
No off target data available for this crispr