ID: 948314662

View in Genome Browser
Species Human (GRCh38)
Location 2:237018167-237018189
Sequence GCCACGGATGTTCCCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948314662_948314669 16 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314669 2:237018206-237018228 ACTTATTTGGTTTTCTGGGAAGG No data
948314662_948314663 -10 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314663 2:237018180-237018202 CATCCGTGGCAAAATGTCACTGG No data
948314662_948314671 26 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314671 2:237018216-237018238 TTTTCTGGGAAGGGAAGAAGAGG No data
948314662_948314667 11 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314667 2:237018201-237018223 GGGACACTTATTTGGTTTTCTGG No data
948314662_948314668 12 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314668 2:237018202-237018224 GGACACTTATTTGGTTTTCTGGG No data
948314662_948314666 3 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314666 2:237018193-237018215 ATGTCACTGGGACACTTATTTGG No data
948314662_948314664 -9 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314664 2:237018181-237018203 ATCCGTGGCAAAATGTCACTGGG No data
948314662_948314670 17 Left 948314662 2:237018167-237018189 CCAACAGTGGGAACATCCGTGGC No data
Right 948314670 2:237018207-237018229 CTTATTTGGTTTTCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948314662 Original CRISPR GCCACGGATGTTCCCACTGT TGG (reversed) Intergenic
No off target data available for this crispr