ID: 948317211

View in Genome Browser
Species Human (GRCh38)
Location 2:237037386-237037408
Sequence TAGTGGTGGTGTCCCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948317206_948317211 -5 Left 948317206 2:237037368-237037390 CCTAGAATGATTCCACAATAGTG No data
Right 948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG No data
948317205_948317211 1 Left 948317205 2:237037362-237037384 CCAGGTCCTAGAATGATTCCACA No data
Right 948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG No data
948317203_948317211 14 Left 948317203 2:237037349-237037371 CCTACATCCTGTGCCAGGTCCTA No data
Right 948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG No data
948317204_948317211 7 Left 948317204 2:237037356-237037378 CCTGTGCCAGGTCCTAGAATGAT No data
Right 948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG No data
948317202_948317211 15 Left 948317202 2:237037348-237037370 CCCTACATCCTGTGCCAGGTCCT No data
Right 948317211 2:237037386-237037408 TAGTGGTGGTGTCCCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948317211 Original CRISPR TAGTGGTGGTGTCCCCTGCT GGG Intergenic
No off target data available for this crispr