ID: 948319115

View in Genome Browser
Species Human (GRCh38)
Location 2:237055488-237055510
Sequence TCCCTTCCATTGGGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948319115_948319126 21 Left 948319115 2:237055488-237055510 CCTCTGGCCCCCAATGGAAGGGA No data
Right 948319126 2:237055532-237055554 GAGAAACTCTGGAAGGAATGTGG No data
948319115_948319125 14 Left 948319115 2:237055488-237055510 CCTCTGGCCCCCAATGGAAGGGA No data
Right 948319125 2:237055525-237055547 CATGTATGAGAAACTCTGGAAGG No data
948319115_948319127 22 Left 948319115 2:237055488-237055510 CCTCTGGCCCCCAATGGAAGGGA No data
Right 948319127 2:237055533-237055555 AGAAACTCTGGAAGGAATGTGGG No data
948319115_948319123 10 Left 948319115 2:237055488-237055510 CCTCTGGCCCCCAATGGAAGGGA No data
Right 948319123 2:237055521-237055543 AATCCATGTATGAGAAACTCTGG No data
948319115_948319128 23 Left 948319115 2:237055488-237055510 CCTCTGGCCCCCAATGGAAGGGA No data
Right 948319128 2:237055534-237055556 GAAACTCTGGAAGGAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948319115 Original CRISPR TCCCTTCCATTGGGGGCCAG AGG (reversed) Intergenic