ID: 948321670

View in Genome Browser
Species Human (GRCh38)
Location 2:237074749-237074771
Sequence CTGAGTCAGGACATATGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948321670_948321675 27 Left 948321670 2:237074749-237074771 CCACGACATATGTCCTGACTCAG No data
Right 948321675 2:237074799-237074821 CTTCAATGATGTCATGTGCCTGG No data
948321670_948321673 3 Left 948321670 2:237074749-237074771 CCACGACATATGTCCTGACTCAG No data
Right 948321673 2:237074775-237074797 ACAGCTAATGAGTGTGAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948321670 Original CRISPR CTGAGTCAGGACATATGTCG TGG (reversed) Intergenic
No off target data available for this crispr