ID: 948331200

View in Genome Browser
Species Human (GRCh38)
Location 2:237167119-237167141
Sequence CTGGTTCTGCAGATCTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948331200_948331204 0 Left 948331200 2:237167119-237167141 CCTATAAAGATCTGCAGAACCAG No data
Right 948331204 2:237167142-237167164 ACTCAGGCAGAAACCAGGAGAGG No data
948331200_948331208 27 Left 948331200 2:237167119-237167141 CCTATAAAGATCTGCAGAACCAG No data
Right 948331208 2:237167169-237167191 CCACTGCCAGCATCTCAATAGGG No data
948331200_948331202 -5 Left 948331200 2:237167119-237167141 CCTATAAAGATCTGCAGAACCAG No data
Right 948331202 2:237167137-237167159 ACCAGACTCAGGCAGAAACCAGG No data
948331200_948331209 28 Left 948331200 2:237167119-237167141 CCTATAAAGATCTGCAGAACCAG No data
Right 948331209 2:237167170-237167192 CACTGCCAGCATCTCAATAGGGG No data
948331200_948331206 26 Left 948331200 2:237167119-237167141 CCTATAAAGATCTGCAGAACCAG No data
Right 948331206 2:237167168-237167190 ACCACTGCCAGCATCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948331200 Original CRISPR CTGGTTCTGCAGATCTTTAT AGG (reversed) Intergenic
No off target data available for this crispr