ID: 948334131

View in Genome Browser
Species Human (GRCh38)
Location 2:237194360-237194382
Sequence GCACAATCCCTGGCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948334128_948334131 -1 Left 948334128 2:237194338-237194360 CCTGGGGACACAGAACATGGAGG No data
Right 948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG No data
948334121_948334131 19 Left 948334121 2:237194318-237194340 CCACAGCCAATGCCTGGCAGCCT No data
Right 948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG No data
948334119_948334131 30 Left 948334119 2:237194307-237194329 CCAAAGGTGTTCCACAGCCAATG No data
Right 948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG No data
948334126_948334131 7 Left 948334126 2:237194330-237194352 CCTGGCAGCCTGGGGACACAGAA No data
Right 948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG No data
948334125_948334131 13 Left 948334125 2:237194324-237194346 CCAATGCCTGGCAGCCTGGGGAC No data
Right 948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948334131 Original CRISPR GCACAATCCCTGGCCCAAGC TGG Intergenic
No off target data available for this crispr