ID: 948335947

View in Genome Browser
Species Human (GRCh38)
Location 2:237207185-237207207
Sequence AGCACGGCTGAACCCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948335939_948335947 26 Left 948335939 2:237207136-237207158 CCAATGAGGGCACACAGGATCTC No data
Right 948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG No data
948335937_948335947 28 Left 948335937 2:237207134-237207156 CCCCAATGAGGGCACACAGGATC No data
Right 948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG No data
948335943_948335947 -5 Left 948335943 2:237207167-237207189 CCTGGGAGCCACATCGTCAGCAC No data
Right 948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG No data
948335942_948335947 4 Left 948335942 2:237207158-237207180 CCATGTCATCCTGGGAGCCACAT No data
Right 948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG No data
948335938_948335947 27 Left 948335938 2:237207135-237207157 CCCAATGAGGGCACACAGGATCT No data
Right 948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948335947 Original CRISPR AGCACGGCTGAACCCACCCA GGG Intergenic
No off target data available for this crispr