ID: 948337849

View in Genome Browser
Species Human (GRCh38)
Location 2:237224473-237224495
Sequence TTTCTGCTTTCACCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948337845_948337849 -1 Left 948337845 2:237224451-237224473 CCCTGCCCTGCAACAAAATTATT No data
Right 948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG No data
948337848_948337849 -7 Left 948337848 2:237224457-237224479 CCTGCAACAAAATTATTTTCTGC No data
Right 948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG No data
948337846_948337849 -2 Left 948337846 2:237224452-237224474 CCTGCCCTGCAACAAAATTATTT No data
Right 948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG No data
948337847_948337849 -6 Left 948337847 2:237224456-237224478 CCCTGCAACAAAATTATTTTCTG No data
Right 948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948337849 Original CRISPR TTTCTGCTTTCACCAAACCC AGG Intergenic
No off target data available for this crispr