ID: 948339794

View in Genome Browser
Species Human (GRCh38)
Location 2:237240342-237240364
Sequence GGAATAAGGCCCTCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948339786_948339794 28 Left 948339786 2:237240291-237240313 CCCCCACCTTTAGGGAACAGTCG No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data
948339787_948339794 27 Left 948339787 2:237240292-237240314 CCCCACCTTTAGGGAACAGTCGT No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data
948339791_948339794 2 Left 948339791 2:237240317-237240339 CCTATAAAACACTTAGCTGCAGT No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data
948339790_948339794 22 Left 948339790 2:237240297-237240319 CCTTTAGGGAACAGTCGTAGCCT No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data
948339789_948339794 25 Left 948339789 2:237240294-237240316 CCACCTTTAGGGAACAGTCGTAG No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data
948339788_948339794 26 Left 948339788 2:237240293-237240315 CCCACCTTTAGGGAACAGTCGTA No data
Right 948339794 2:237240342-237240364 GGAATAAGGCCCTCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948339794 Original CRISPR GGAATAAGGCCCTCAGCAAC AGG Intergenic