ID: 948342290

View in Genome Browser
Species Human (GRCh38)
Location 2:237263590-237263612
Sequence GCCACTCGACATCAGGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948342290_948342294 -5 Left 948342290 2:237263590-237263612 CCACAATCCTGATGTCGAGTGGC No data
Right 948342294 2:237263608-237263630 GTGGCCAGTGGGCTCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948342290 Original CRISPR GCCACTCGACATCAGGATTG TGG (reversed) Intergenic
No off target data available for this crispr