ID: 948348524

View in Genome Browser
Species Human (GRCh38)
Location 2:237319481-237319503
Sequence GTGCCCAAACAGACTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948348524_948348530 28 Left 948348524 2:237319481-237319503 CCCACCTCAGTCTGTTTGGGCAC No data
Right 948348530 2:237319532-237319554 AAAAAGCAGGCAGAAAAACGTGG No data
948348524_948348528 15 Left 948348524 2:237319481-237319503 CCCACCTCAGTCTGTTTGGGCAC No data
Right 948348528 2:237319519-237319541 CAGTGCAGCCAGAAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948348524 Original CRISPR GTGCCCAAACAGACTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr