ID: 948348971

View in Genome Browser
Species Human (GRCh38)
Location 2:237322766-237322788
Sequence CCTACGAGGTGCAGTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948348966_948348971 -5 Left 948348966 2:237322748-237322770 CCTTCAGCCCTCTGCTGGCCTAC 0: 1
1: 0
2: 0
3: 31
4: 361
Right 948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 75
948348962_948348971 26 Left 948348962 2:237322717-237322739 CCGTGGAAACAGGTGTATGACTA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 75
948348963_948348971 3 Left 948348963 2:237322740-237322762 CCCAAACTCCTTCAGCCCTCTGC 0: 1
1: 0
2: 2
3: 26
4: 310
Right 948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 75
948348961_948348971 27 Left 948348961 2:237322716-237322738 CCCGTGGAAACAGGTGTATGACT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 75
948348964_948348971 2 Left 948348964 2:237322741-237322763 CCAAACTCCTTCAGCCCTCTGCT 0: 1
1: 0
2: 5
3: 47
4: 488
Right 948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948348971 Original CRISPR CCTACGAGGTGCAGTGCCAC AGG Intergenic
900314973 1:2051902-2051924 CCTTCGGGGTGCAGTGGCCCGGG + Intronic
901448887 1:9324370-9324392 CCTACCACGTGCTGAGCCACAGG - Intronic
902690033 1:18105312-18105334 CCAAGGAGGTTCACTGCCACAGG + Intergenic
907490519 1:54806199-54806221 CCTTCGGGGTGCAGAGCCACAGG + Exonic
924707824 1:246512915-246512937 CCTACGGGATGCAGGGCCTCTGG + Intergenic
1071276965 10:84064261-84064283 CCTATGAGCTGCAGTGCAATTGG + Intergenic
1074714865 10:116209011-116209033 CATACGAGTTCCAGGGCCACGGG - Intronic
1075251281 10:120876473-120876495 CTTTTGAGGTGCAGTGACACAGG + Intronic
1079005804 11:16790363-16790385 CCTACAGGGTGCAGTGACTCTGG + Intronic
1079079057 11:17401421-17401443 CCTAAGAGGTGGATTTCCACTGG + Intronic
1083782269 11:64924748-64924770 CCAACGCGGTGCAGCGCAACGGG - Exonic
1090627424 11:128618974-128618996 CCTAAGACGTGCAGTGACTCAGG + Intergenic
1091774471 12:3175388-3175410 CCTGTGAGCTGCAGTGGCACGGG + Intronic
1101791690 12:107933513-107933535 CCTACCATGTGCTGTGCCCCAGG - Intergenic
1103477895 12:121232212-121232234 CCCACGAGGTACAGGGGCACAGG - Intronic
1103913991 12:124367173-124367195 CCTACTAGGTGAGGGGCCACAGG - Intronic
1116842150 14:49829884-49829906 CCTGCCAGGTGCAGTGGCTCAGG - Intronic
1118024426 14:61754443-61754465 CCTTGGAGGTGGAGTGCCAAAGG - Intergenic
1119685336 14:76626556-76626578 CCTTTGAGGTGCAATGCCAAGGG - Intergenic
1121539383 14:94713557-94713579 CATACGACGTGAAATGCCACCGG - Intergenic
1124515945 15:30367565-30367587 CCTGTGACGTGCAGTGCCACAGG - Intronic
1124726975 15:32163166-32163188 CCTGTGACGTGCAGTGCCACAGG + Intronic
1128219488 15:65958158-65958180 CCTACAATGTGGAGAGCCACTGG - Intronic
1131648033 15:94367053-94367075 CCTAATAGGCACAGTGCCACAGG - Intronic
1132244151 15:100281271-100281293 CCGACATGGTGCAGTACCACGGG - Exonic
1132349784 15:101132621-101132643 TCTGCGAGGTCCTGTGCCACCGG - Intergenic
1141706329 16:85667179-85667201 TCTACAAGGTGCACTGCCAAAGG - Intronic
1143406507 17:6681221-6681243 CCTTCCAGCTGCAGAGCCACAGG - Intergenic
1143661168 17:8325398-8325420 GCTATGAGGAGCAGGGCCACGGG - Intergenic
1145747826 17:27333078-27333100 CCCACGAGCTGCTGTGCCATTGG + Intergenic
1146744099 17:35313277-35313299 CCTACGTGGTTGAGAGCCACAGG + Intergenic
1151263002 17:72931431-72931453 CCTTCGAGGCACAGTCCCACAGG - Intronic
1157812722 18:50709273-50709295 CCAAGGAAGTGCAGTGCCAGGGG + Intronic
1162124576 19:8492536-8492558 CCTACCGGGTGCAGTGGCTCAGG - Intronic
1163222478 19:15931426-15931448 CCTCAGAGGTGCAGTAACACAGG + Intronic
1164609540 19:29622764-29622786 CCAAACAGGTGCTGTGCCACAGG + Intergenic
925159532 2:1674437-1674459 TCTTCGTGGTGCAGTGCCACAGG - Intronic
925251228 2:2440588-2440610 CCTGCGAGATGGAGTTCCACAGG - Intergenic
925313192 2:2902433-2902455 CCTAGGAGAAGCAGTGCCAAGGG + Intergenic
926581184 2:14633858-14633880 CCCAAGACGTGCAGTGCCCCTGG - Intronic
927436807 2:23073622-23073644 CCTACAAGGGGCAATGCCAATGG + Intergenic
932353490 2:71050081-71050103 CCTAGGAGGTGCAGTTGTACTGG + Intergenic
946364230 2:219238700-219238722 CTTACCAGGTGCAGAGTCACAGG + Exonic
948348971 2:237322766-237322788 CCTACGAGGTGCAGTGCCACAGG + Intergenic
1175681636 20:60993601-60993623 CTTATGAGGTGCAGTCCCCCAGG - Intergenic
1176407695 21:6430399-6430421 TCTACCAGGTACAGAGCCACCGG - Intergenic
1179683185 21:43038730-43038752 TCTACCAGGTACAGAGCCACCGG - Intergenic
1180086804 21:45511209-45511231 CCTACCAGGTGGGGTGCCTCAGG - Exonic
1180705220 22:17805332-17805354 CCAAGGAGGGGCAGGGCCACGGG + Intronic
1181443913 22:22953714-22953736 CCTGCAAGGGGCAGTGCCCCAGG + Intergenic
1182909799 22:33972717-33972739 CCTAAGAGGAGCAGGGCCATTGG + Intergenic
1183725037 22:39583881-39583903 CCTACTATGTGCAGGGCCAGTGG - Intronic
1185179296 22:49349982-49350004 CCTGTGAGGAGCAGAGCCACAGG + Intergenic
1185242688 22:49755122-49755144 CCTGCGATGTGCAGTGGCAGGGG - Intergenic
954197971 3:49007582-49007604 CCTCCCAGGGGCGGTGCCACAGG + Intronic
955298535 3:57756282-57756304 CCTACCCGGTGCACCGCCACGGG - Exonic
956773696 3:72548090-72548112 CCTACTAGGTGCAAGGGCACTGG + Intergenic
958909411 3:99976953-99976975 CCTGCAAGGTGCAGTCACACAGG - Intronic
961814986 3:129544771-129544793 CCTCCCAGCTGCAGTGCTACAGG - Intronic
970292472 4:14589221-14589243 CCTAGAAGGTACTGTGCCACAGG + Intergenic
974859016 4:67496971-67496993 CCTCCGAGGCCCAGTGTCACAGG - Intronic
978796373 4:112711962-112711984 ACTGCTAGGTGCAGTGGCACAGG - Intergenic
986006464 5:3672692-3672714 CCTAGGAGCTGCTGTGACACAGG + Intergenic
986157022 5:5186279-5186301 CCTACGAAGTGCAATGACACAGG - Intronic
988515209 5:31898569-31898591 CCTTAGAGGCGCAGTACCACTGG + Intronic
1000150713 5:158497984-158498006 CCTACGAGTTGGAATTCCACAGG + Intergenic
1000419306 5:161020246-161020268 CCTCTGAGGTGCAGTGCCTCAGG + Intergenic
1002586798 5:180253639-180253661 GCTTCCAGGTGCAGGGCCACAGG + Intronic
1006679534 6:35787244-35787266 GCTTGGAGGTGCAGTCCCACGGG - Intronic
1006737504 6:36284991-36285013 CCTCCGAGGAGCAGTGACCCTGG - Intronic
1010676975 6:78756519-78756541 CCGTCAAGGTGCAGTGCCACAGG - Intergenic
1015329772 6:131963293-131963315 CATAAGAGATGTAGTGCCACAGG - Intergenic
1016254062 6:142082678-142082700 CCTGCAAGGTGCAGTGCAATGGG + Intronic
1016449509 6:144166974-144166996 CCTCAGAGATGCAGGGCCACAGG - Intronic
1030152937 7:106424541-106424563 CCTACTAGGTTCAGTTGCACTGG - Intergenic
1037228025 8:16619465-16619487 CCTGTGAGGGGCAGTGGCACAGG - Intergenic
1037784973 8:21897268-21897290 CCTAAGAAGTCCAGTGCCCCAGG + Intergenic
1038927012 8:32151791-32151813 CCTATGAGGCGCAGTGCCTTTGG + Intronic
1046640904 8:116730301-116730323 CCTATGAGAATCAGTGCCACTGG - Intronic
1060791257 9:126487073-126487095 CCCAGGAGGTGCAGAGCCAGGGG + Intronic
1185462981 X:340847-340869 TCTACGAGGAGCAGTGCCGAAGG - Exonic
1190082393 X:47366554-47366576 CCTAGAAGGTGCAGTGTCAGGGG + Intergenic
1201927170 Y:19299910-19299932 ACTGAGAGGTGAAGTGCCACAGG + Intergenic