ID: 948350999

View in Genome Browser
Species Human (GRCh38)
Location 2:237340785-237340807
Sequence CAGGGGAATGACACAGTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948350999_948351004 5 Left 948350999 2:237340785-237340807 CCTGCAACTGTGTCATTCCCCTG 0: 1
1: 0
2: 8
3: 83
4: 354
Right 948351004 2:237340813-237340835 GAAGTCCACCAGCTTCTCCTTGG 0: 1
1: 0
2: 2
3: 18
4: 195
948350999_948351009 23 Left 948350999 2:237340785-237340807 CCTGCAACTGTGTCATTCCCCTG 0: 1
1: 0
2: 8
3: 83
4: 354
Right 948351009 2:237340831-237340853 CTTGGAGCCATAGTCAGTCAGGG 0: 1
1: 1
2: 0
3: 12
4: 108
948350999_948351008 22 Left 948350999 2:237340785-237340807 CCTGCAACTGTGTCATTCCCCTG 0: 1
1: 0
2: 8
3: 83
4: 354
Right 948351008 2:237340830-237340852 CCTTGGAGCCATAGTCAGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948350999 Original CRISPR CAGGGGAATGACACAGTTGC AGG (reversed) Exonic
900323865 1:2097914-2097936 CAGGGGAACCACACAGCAGCAGG - Intronic
901840177 1:11949374-11949396 CAGGGGAGGGTCAGAGTTGCTGG + Intronic
902052225 1:13572992-13573014 TAGGGGAAGGACACAGCAGCAGG + Intergenic
902970961 1:20049515-20049537 CATGGGAAGGACACAGTGGGAGG + Intronic
903635040 1:24807482-24807504 TAGGGGAAAGACACAGCAGCAGG - Intronic
904569678 1:31453683-31453705 TAGGGGAATGACACAACAGCAGG - Intergenic
904571793 1:31471525-31471547 TAGGGGAATGACACAACAGCAGG - Intergenic
904712662 1:32442483-32442505 TAGGGGAATGACACAGCGGCAGG - Intergenic
904713564 1:32449588-32449610 TAGGGGAACGACACAGCAGCAGG - Intergenic
906507880 1:46393691-46393713 CAGGGGAAGGACACAGCATCAGG - Intergenic
907176527 1:52528346-52528368 CAGGCGCATGCCACAGTGGCCGG - Intronic
907579128 1:55556107-55556129 CAGGGGGATGAGACAGAAGCAGG - Intergenic
909003746 1:70250836-70250858 CAAAGGAATGACACTGATGCAGG - Exonic
909014344 1:70367043-70367065 TAGGGGAATGACACAGCAACAGG - Intronic
909238714 1:73184008-73184030 CAGGGGAACGACACAGCAGCAGG + Intergenic
911765133 1:101665058-101665080 TAGGGGAATGACACAGCTGTAGG + Intergenic
912412790 1:109489885-109489907 CAGGGGAATGTGACTGTTGTGGG - Intronic
912462425 1:109844857-109844879 CATGGCAATCACACCGTTGCTGG + Intergenic
915006679 1:152644678-152644700 CAGGGGGCTGACACTGCTGCTGG + Intergenic
915949307 1:160177497-160177519 CCTGTGAATGACAGAGTTGCAGG - Exonic
916451214 1:164922271-164922293 CATGGTAATAACAAAGTTGCTGG + Intergenic
917099264 1:171429274-171429296 CAGGGGAAGGACACAGAAACAGG + Intergenic
917312548 1:173691898-173691920 TAGGGGAATAACACAGCAGCAGG - Intergenic
922276816 1:224086830-224086852 TAGGGGAACGACACAGCAGCAGG + Intergenic
923111840 1:230897179-230897201 CAGTGGAATAATACAGTTTCTGG - Intergenic
923843901 1:237706810-237706832 CAGGAGAAGGAGCCAGTTGCAGG + Intronic
924734974 1:246747666-246747688 AAGGGGAATGACACAGCAGTAGG - Intronic
1063309545 10:4939341-4939363 CAGGGGAAAGACACAGCAGAAGG + Intronic
1063821780 10:9844525-9844547 TAGGGGAATGACACAGCAGTAGG + Intergenic
1064444166 10:15378969-15378991 CAGGCGAATGCCACAATGGCTGG + Intergenic
1064756693 10:18577909-18577931 TAGGGGAATGACACAGCAGCAGG + Intronic
1064773760 10:18752759-18752781 TAGGGGAATGACACAGCAGCAGG + Intergenic
1064827366 10:19420140-19420162 CAGGGGAACGACAGAGCAGCAGG - Intronic
1065464295 10:26002443-26002465 TAGGGGAACGACACAGCAGCAGG - Intronic
1065810566 10:29439029-29439051 CAGGGGAATGACACAGCAGCAGG - Intergenic
1065888467 10:30100044-30100066 CAGGGGAAGGACACAGCAGCAGG + Intronic
1068110474 10:52674317-52674339 CAGGGGAGGGACCCAGTGGCTGG + Intergenic
1069438187 10:68405403-68405425 CAGGAGAATGGCAGATTTGCAGG - Intronic
1070637767 10:78142800-78142822 CATGGGAAGGACCCAGTTGGAGG + Intergenic
1070698867 10:78584383-78584405 CAGGAGAAAGACACAGAGGCAGG + Intergenic
1071282877 10:84118725-84118747 TAGGGGAACGACACAGCAGCAGG - Intergenic
1071283873 10:84126364-84126386 TAGGGGAACGACACAGCAGCAGG - Intergenic
1071453826 10:85826486-85826508 CGGGGGAGGGTCACAGTTGCTGG - Intronic
1072215267 10:93282455-93282477 CAGAGGAATGACATTGTTACAGG + Intergenic
1075807745 10:125202288-125202310 CAGGGGAATGACATATCTGATGG + Intergenic
1077193019 11:1263344-1263366 CAGGGGCCTGACAAGGTTGCAGG + Intergenic
1077362382 11:2146398-2146420 CTGGGGAAGGACACACTCGCTGG + Intronic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1077559773 11:3252353-3252375 TAGGGGAATGACACAGCAGTAGG + Intergenic
1077565666 11:3298156-3298178 TAGGGGAATGACACAGCAGTAGG + Intergenic
1077937486 11:6802879-6802901 TAGGGGAACGACACAGCAGCAGG - Intergenic
1079104691 11:17563096-17563118 CAGGTGATTGACACAGTTCAAGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1081345382 11:41979295-41979317 TAGGGGAATGGCACAGCAGCAGG + Intergenic
1083080902 11:60092436-60092458 CAGGTGCATGCCACAGTGGCTGG + Intronic
1085318558 11:75560935-75560957 CAGGTGATTGACTCATTTGCTGG + Intergenic
1085544013 11:77300264-77300286 TAGGGGAACGACACAGCAGCAGG + Intronic
1085799703 11:79578024-79578046 TAGGCTAATGACACAGTTGAAGG - Intergenic
1086825312 11:91489070-91489092 TAGGGGAATGACACAGCAGGAGG - Intergenic
1086987810 11:93269008-93269030 TAGGGGAATGACACAGCAGTAGG + Intergenic
1087639824 11:100744949-100744971 TAGGGGAACGACACAGCAGCGGG - Intronic
1087640509 11:100750311-100750333 TAGGGGAAAGACACAGCAGCAGG - Intronic
1087640550 11:100750556-100750578 TAGGGGAAGGACACAGCAGCAGG - Intronic
1088072070 11:105799395-105799417 GATGGGAATGAGTCAGTTGCTGG + Intronic
1088834344 11:113565280-113565302 CTGGGGAAGGGCACAGTAGCAGG + Intergenic
1088913376 11:114208992-114209014 CAAGGGAATTACACAGTTTGGGG - Intronic
1089607459 11:119649743-119649765 CACGGGAATGGCAGAGTTTCTGG + Intronic
1089956952 11:122580301-122580323 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1090105733 11:123852158-123852180 CAGAGGGATGACACAGAGGCTGG - Intergenic
1090217793 11:124984817-124984839 CAGAGGGAAGACACAGATGCTGG - Intronic
1090324402 11:125872091-125872113 CAGGGGAATGACACAGCAGTAGG - Intergenic
1091034614 11:132222048-132222070 CAGCGCGATGACACAGGTGCGGG - Intronic
1091342814 11:134831540-134831562 AAGGGGAATAACAAAGTTGGAGG + Intergenic
1092847320 12:12595885-12595907 TAGGGGAACGACACAGCAGCAGG - Intergenic
1093356348 12:18172967-18172989 TAGGGGAATGACATAGCAGCAGG + Intronic
1093950492 12:25160594-25160616 TAGGGGAATGACACAGTAGCAGG + Intronic
1094113210 12:26883175-26883197 CATGGGCAAGACACAGTTGTAGG - Intergenic
1094291712 12:28858034-28858056 CAGGGCAATCCCACAGATGCTGG - Intergenic
1094475471 12:30837392-30837414 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1094583824 12:31758670-31758692 TAGGGGAATGACACAGCAGCAGG + Intergenic
1095149561 12:38776238-38776260 CAGAGGAATTAAACTGTTGCAGG - Exonic
1095745436 12:45653182-45653204 AAGGAGAATGCCACATTTGCAGG + Intergenic
1096179448 12:49542621-49542643 CAGGTGTAGGACACAGTTGCTGG - Intronic
1097313168 12:58143558-58143580 GACGGGAAAGACACAGTTTCAGG - Intergenic
1097519707 12:60651992-60652014 TAGGGGAATGACACAGCAGTAGG - Intergenic
1097844918 12:64356481-64356503 CAGGGGAATGACACAGCAGTAGG - Intronic
1098016932 12:66114984-66115006 CAGGGGCAGGACACAGTGACAGG + Intergenic
1099140248 12:78964711-78964733 GAGGAGACTGAGACAGTTGCAGG - Intronic
1099150922 12:79112493-79112515 CAGGGGAATGACATTATTGGAGG + Intronic
1099798376 12:87426225-87426247 CAGGGGAAAGACACAGCAGTAGG + Intergenic
1100228476 12:92583096-92583118 CAATGGAATGAGGCAGTTGCAGG + Intergenic
1100716867 12:97315199-97315221 TAGGGGAATGACACAGCAGCAGG - Intergenic
1101387677 12:104272249-104272271 TAGGGGAAAGACACAGCAGCAGG - Intronic
1101565199 12:105898330-105898352 TAGGGGAACGACACAGCAGCAGG - Intergenic
1101855961 12:108443194-108443216 TTGGGGAATGACACAGCAGCAGG + Intergenic
1104427298 12:128688115-128688137 CACGGGCATGCCACAGTTGCTGG + Intronic
1104618931 12:130295008-130295030 GAGGAGGAAGACACAGTTGCTGG + Intergenic
1104702855 12:130920343-130920365 CACGTGAAGGACACAGTTGCTGG + Intergenic
1105458789 13:20565420-20565442 CAGGGGAAGGACACAGCAGCAGG + Intergenic
1105569069 13:21582793-21582815 TAGGGGAAAGACACAGCAGCAGG + Intronic
1106096202 13:26646520-26646542 GAGGGGAGTGACACAGGTGTGGG - Intronic
1106585219 13:31051410-31051432 CAGGTAAATGACACTGTTCCTGG + Intergenic
1109909224 13:68888825-68888847 TAGGGGAATGACACAGCAGCAGG - Intergenic
1110137161 13:72082130-72082152 CTGAGGAATGACACAGATTCTGG - Intergenic
1110496657 13:76175479-76175501 CATGGGAATGACTCAGTGGGAGG - Intergenic
1110756392 13:79179665-79179687 TAGGGGAATGACACAGCAGCAGG - Intergenic
1110965131 13:81685294-81685316 CATGCGGATGACACAGCTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112538859 13:100286342-100286364 CAGGGGAACAACACAGCAGCAGG - Intronic
1114146364 14:19982189-19982211 TAGTGGAATGACACAGCAGCAGG + Intergenic
1114223196 14:20715353-20715375 CAGGGGAAAGACACAGCAGTAGG - Intergenic
1114236509 14:20828431-20828453 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1116056478 14:39870609-39870631 CAGGGCAAGGACAGAGTGGCAGG + Intergenic
1116649140 14:47566770-47566792 CAGAGGGAGGACACAGATGCTGG - Intronic
1116726188 14:48563788-48563810 CAGGGGAATGACACAGCACTAGG + Intergenic
1119692039 14:76680991-76681013 CAGGGGAATGACACAGCAGCAGG + Intergenic
1119751235 14:77079011-77079033 CAGTGGAATGAGACTTTTGCTGG - Intergenic
1120395721 14:83964690-83964712 TAGGGGAACGACACAGCTGCAGG + Intergenic
1123174804 14:106406555-106406577 CAGGGCAATGAGACAGTAGAAGG - Intergenic
1123721196 15:23063512-23063534 CAGAGGGAGGACACAGATGCTGG + Intergenic
1124888375 15:33708842-33708864 TAGGGGAACGACACAGCAGCAGG - Intronic
1124934191 15:34154879-34154901 TAGGGGAATGACACAGTAGTAGG - Intronic
1125690583 15:41593067-41593089 TAGGGGAATGACCCAGCAGCAGG + Intergenic
1126544732 15:49861020-49861042 CAGGGGAATGAAAGAGTTGTGGG - Intronic
1127908510 15:63395688-63395710 CAGGGGAACAACACAGCAGCAGG - Intergenic
1129007910 15:72389848-72389870 CAGGAGAATGAAGCAGATGCAGG - Intergenic
1130329380 15:82909357-82909379 CAGGGGAAAGACACAGCAGTAGG - Intronic
1133061446 16:3177419-3177441 TAGGGGAATGACACAGCAGCAGG + Intergenic
1133519022 16:6538980-6539002 CATTGGAATGACACAGTACCTGG - Intronic
1133706330 16:8358413-8358435 CAGGGGAAGGATGCAGTTACTGG - Intergenic
1133960117 16:10486086-10486108 TAGGGGAATGACACAGCAGTAGG + Intergenic
1134250499 16:12570636-12570658 CAAGGGAATGTCACAGATGGGGG - Exonic
1134256243 16:12613985-12614007 TAGGGGAATGACACAGCAGTAGG + Intergenic
1135937483 16:26793449-26793471 CATGGGAAAGACAGAGATGCTGG - Intergenic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1138281084 16:55772749-55772771 GAGGAGAATGCCACCGTTGCAGG - Intergenic
1138296616 16:55891200-55891222 TAGGGGAATGACACAGCTGCAGG + Intronic
1139155467 16:64436337-64436359 TAGGGGAAGGACACAGTTAGAGG + Intergenic
1140301546 16:73762796-73762818 GAGGGGAATGACACAGATTGGGG + Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141833675 16:86524186-86524208 CAGGGCTGTGACACAGGTGCCGG - Intergenic
1143843139 17:9750684-9750706 CCGTGGAAGGACACAGTTGCTGG + Intergenic
1144244279 17:13347534-13347556 TAGGGGAATGACACAGCAGCAGG - Intergenic
1147262987 17:39219537-39219559 TTGGGGACGGACACAGTTGCTGG + Intronic
1148441343 17:47713246-47713268 CAGGGGAATGTCCAGGTTGCAGG - Intergenic
1148683341 17:49486973-49486995 CAGGGCAAGGACACAGGTGGAGG - Intergenic
1148729524 17:49824015-49824037 CAGGTGAATTAGAGAGTTGCTGG + Intronic
1149189262 17:54038955-54038977 CAGGGGACTGATACAGAAGCAGG + Intergenic
1149257236 17:54840506-54840528 CAGGTAAAAGAAACAGTTGCAGG + Intergenic
1149997704 17:61413325-61413347 CTGGGGAATGCCAGAGTTGGAGG + Intergenic
1151029276 17:70717191-70717213 CAGAGGATTTACACAGTTCCAGG + Intergenic
1151420131 17:73991534-73991556 CAGGGGAGAGACCCAGCTGCTGG - Intergenic
1151756454 17:76077943-76077965 CCGGGGAGTGAAACAGCTGCTGG - Intronic
1151894462 17:76970588-76970610 TAGGGGAACGACACAGCAGCAGG + Intergenic
1151922493 17:77167984-77168006 CAGGGGAAGGACACAGGGACAGG - Intronic
1152239993 17:79156091-79156113 CTGGGGACTGACACACTTGGGGG + Intronic
1152605715 17:81288715-81288737 CAGGGGAAGGACACAGCCACTGG + Intronic
1153238584 18:3011865-3011887 CAGGGGATGGAGACAGGTGCTGG - Exonic
1153417959 18:4870509-4870531 CAGAGGAATGACACAGCAGTAGG + Intergenic
1153826112 18:8876414-8876436 TAGGGGAATGACACAGCAGCAGG + Intergenic
1153826874 18:8882967-8882989 TAGGGGAACGACACAGCAGCAGG - Intergenic
1153869544 18:9304697-9304719 TAGGGGAATGACACAGCAGTAGG - Intergenic
1153881168 18:9422903-9422925 TAGGGGAACGACACAGCAGCAGG - Intergenic
1154157727 18:11956992-11957014 CAGGGGAATGACACAGCAGTAGG + Intergenic
1155803642 18:30139973-30139995 CAGGGGAACGACACAGCAGTAGG + Intergenic
1157002254 18:43541252-43541274 CAAGGGAATTTCACAATTGCAGG + Intergenic
1157249665 18:46083509-46083531 CAGGGAAATGAAAAAATTGCTGG - Exonic
1157571343 18:48714353-48714375 CAGAGGCATGGCACAGATGCTGG - Intronic
1157758474 18:50240471-50240493 TAGCGGAATGACACAGCAGCAGG + Intronic
1158609244 18:58923812-58923834 GAGGGGCTTGGCACAGTTGCCGG - Intronic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1158908306 18:62035437-62035459 CAGGGGAACTCCACAGCTGCGGG - Intergenic
1160083864 18:75756013-75756035 CAGGAGAAGAACACAGTTGTGGG - Intergenic
1162268751 19:9597026-9597048 TAGGGGAATGACACAGCAGTAGG - Intergenic
1163050264 19:14677909-14677931 TAGGGGAACGACACAGCAGCAGG - Intronic
1163077986 19:14912895-14912917 CAGGGGAACGACACAGCAGTAGG - Intergenic
1163215553 19:15874098-15874120 TAGGGGAACGACACAGCAGCAGG + Intergenic
1163506406 19:17709698-17709720 CAGGGGGAGGACAGAGCTGCTGG - Intergenic
1163839776 19:19599997-19600019 CAGGTGCATGACACTGTTCCTGG - Intronic
1163929553 19:20375879-20375901 TAGGGGAAAGACACAGCAGCAGG + Intergenic
1164242024 19:23397640-23397662 TAGGGGAATGACACAGCAGTAGG + Intergenic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1164759582 19:30718995-30719017 CAGAGGGATGACAAAGTTGAGGG + Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165190921 19:34062784-34062806 CAGGCGCATGTCACAATTGCAGG - Intergenic
1165342824 19:35224836-35224858 CAGGAGAAGCACACAGGTGCTGG - Exonic
1165673580 19:37701525-37701547 TAGGGGAACGACACAGCAGCAGG + Intronic
1167906608 19:52665749-52665771 TAGGGGAATGACACAGCAGCAGG + Intronic
1168694897 19:58398540-58398562 CAAGGGAGTGACAGAATTGCAGG + Intergenic
925414621 2:3660662-3660684 TAGGGGAATGATACAGCAGCAGG - Intronic
926543425 2:14209061-14209083 CAGGAGAGTGATAAAGTTGCCGG - Intergenic
927575539 2:24199194-24199216 TAGGGGAATGACACAGCCGCAGG - Intronic
928439912 2:31283817-31283839 TAGGGGAACGACACAGCAGCAGG + Intergenic
930496468 2:52151074-52151096 CATGGGAATGACCCAGTGGGAGG - Intergenic
930979837 2:57510434-57510456 CAGAGGAAAGCCAAAGTTGCTGG + Intergenic
931363499 2:61598574-61598596 TAGGGGAATGACGCAGCAGCAGG - Intergenic
931576190 2:63721569-63721591 CAGGAGAATGAGAAAGTTACTGG - Intronic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
935047663 2:99496979-99497001 TAGGGGAATGACACAGCAACAGG + Intergenic
935048620 2:99504309-99504331 TAGGGGAACGACACAGCAGCAGG + Intergenic
935805055 2:106737420-106737442 CAGGGGAAGGACCCAGTAGGAGG + Intergenic
935958978 2:108405093-108405115 CAGGGGAAAGACACAGCAGTAGG + Intergenic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
937169605 2:119852313-119852335 CAGGGGAAGGACACAGAAACAGG + Intronic
937649183 2:124300697-124300719 CAAGGGAATGAAAAAGTTCCTGG - Intronic
939166308 2:138644798-138644820 CAGGGGAACGACACAGCAACAGG - Intergenic
940303695 2:152202807-152202829 TAGGGGAACGACACAGAAGCAGG + Intergenic
940802245 2:158145533-158145555 GAGGGGAAGGACACAGCAGCAGG + Intergenic
940884001 2:158973130-158973152 CAGAGGGATGACATAGTTCCTGG + Intronic
941876045 2:170434474-170434496 TAGGGGAATGACACAGCAGCAGG - Intronic
941964641 2:171288941-171288963 CAGGGGAGTGAAACAGCGGCAGG + Intergenic
942316325 2:174699592-174699614 TAGGGTGATGACACAGCTGCAGG - Intergenic
943154218 2:184152165-184152187 TAGGGGAACGACACAGCAGCAGG + Intergenic
945483149 2:210365494-210365516 TAGGGGAATGACACAGCAGTAGG - Intergenic
946295045 2:218777329-218777351 TAGGGGAATGACACAGCAGTAGG - Intergenic
946298064 2:218802181-218802203 TAGGGGAACGACACAGCAGCAGG + Intronic
947498023 2:230652974-230652996 TAGGGGAATGACACAGCAGCAGG + Intergenic
947556357 2:231096753-231096775 TAGGGAAATGACACAGCAGCAGG - Intronic
947556832 2:231100342-231100364 CAGGGGAATGACACAGCAGCAGG - Intronic
948109621 2:235444250-235444272 CAGGGGAACGACACAGCAGTAGG - Intergenic
948138623 2:235656641-235656663 CAGGGGAACGACACAGCAGCAGG + Intronic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
948718843 2:239883468-239883490 CAGGGAACAGACACAGTGGCAGG - Intergenic
1168823330 20:792106-792128 TAGGGGAACGACACAGCAGCAGG + Intergenic
1168824509 20:800744-800766 TAGGGGAATGACATAGCAGCAGG + Intergenic
1170404400 20:16021029-16021051 CAGGGGACTGATTCAGTTGGTGG - Intronic
1170505990 20:17026396-17026418 CAGAGGCATGATATAGTTGCTGG + Intergenic
1173578420 20:44128827-44128849 CAGGGGCATGTCACAGTACCCGG + Intronic
1174275696 20:49402332-49402354 TAGGGGAAAGACACAGCAGCAGG + Intronic
1175058693 20:56221531-56221553 TAGGGGAATGACACAGCAGTAGG + Intergenic
1176060830 20:63172182-63172204 CAGGGGAAAGACACAGAGACAGG + Intergenic
1176811037 21:13538608-13538630 TAGGGGAATGACACAGCAGTAGG - Intergenic
1177415075 21:20782316-20782338 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1179105360 21:38395718-38395740 CAGGAAATCGACACAGTTGCTGG - Intronic
1182060143 22:27391478-27391500 CAGAGGCATGACAGAGTTGAAGG + Intergenic
1183557696 22:38543932-38543954 TAGGGGAATGACACAGCAGTAGG + Intronic
1184506200 22:44904943-44904965 CAGCGGAATGACAGATGTGCCGG - Intronic
949163816 3:913096-913118 CAGGGGAACGACACAGCAGTAGG + Intergenic
949638060 3:6005925-6005947 CAAGGGAATGATCCAGTTTCTGG - Intergenic
950567747 3:13781013-13781035 CAGGGGAATCTCTCAGTGGCTGG + Intergenic
950595109 3:13972980-13973002 TAGGGGAATGACACAGCAGTAGG - Intronic
950685216 3:14612327-14612349 AAGGTGAATGCCACAGTTCCAGG - Intergenic
952288225 3:31988742-31988764 AAGGTGACTGACACAGTGGCTGG - Exonic
954604342 3:51897241-51897263 TAGGGGAACGACACAGCAGCAGG + Intronic
954605008 3:51902709-51902731 TAGGGGAATGACACAGCAGCAGG + Intronic
955043904 3:55341934-55341956 CTGGAGAATGTCACTGTTGCTGG - Intergenic
955087146 3:55713906-55713928 CAAGGGAATGGCATAGTCGCAGG - Intronic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
955623289 3:60889254-60889276 CAGGGGAACGACACGGCAGCAGG + Intronic
956042614 3:65160926-65160948 CTGAGGAATGAGACATTTGCAGG - Intergenic
956286805 3:67619225-67619247 AAGTGGAATAACACAGTTTCTGG - Intronic
957975153 3:87433732-87433754 TAGGGGAATGACACAGCAGCAGG + Intergenic
960720900 3:120623476-120623498 TAGGGGAATGACACAGCAGCAGG - Intergenic
961581990 3:127890910-127890932 TAGGGGACTGACACAGCAGCAGG + Intergenic
962562213 3:136618297-136618319 TAAGGGAATGACACAGCAGCAGG + Intronic
963711565 3:148753411-148753433 CAGGGGAACAACACAGCAGCAGG - Intergenic
964710058 3:159662223-159662245 TAGGGGAATGACACAGCAGTAGG + Intronic
966043681 3:175523672-175523694 AAGGGGAAGGACACAGCAGCAGG - Intronic
966065717 3:175819084-175819106 AAGGGGAAAGACACAGCTGTAGG - Intergenic
968854783 4:3111621-3111643 GAGGGGACTGACAGTGTTGCTGG + Intronic
969291777 4:6244777-6244799 TAGGGGAATGACACAGCAGGAGG - Intergenic
971066834 4:23042499-23042521 TAGGGGAATGACACAGCAGCAGG + Intergenic
972022498 4:34333650-34333672 TAGGGCAATGACACAGTACCTGG + Intergenic
972063166 4:34906679-34906701 CATGGGAAAGACACAGTGGGAGG + Intergenic
972784409 4:42313774-42313796 TAGGGGAATGACACAGCAGCAGG + Intergenic
972785230 4:42320429-42320451 TAGGGGAATGACACAGCAGCAGG + Intergenic
975204926 4:71634559-71634581 TAGGGGAAGGACACAGAAGCAGG - Intergenic
975361718 4:73477850-73477872 CAGAGGAAAGACACAGAAGCTGG - Intergenic
975992479 4:80271542-80271564 CAGGAGAAGGCCACAGTAGCAGG + Intronic
976011373 4:80493354-80493376 TAGGGGAATGACACAGTAGCAGG - Intronic
976197029 4:82542797-82542819 CAGGTGAAAGACACACTAGCTGG + Intronic
976312290 4:83623929-83623951 CATGGGAAGGACACAGTGGGAGG + Intergenic
977051841 4:92137992-92138014 CAGGGGAATGACATAAATGTAGG - Intergenic
977482113 4:97592651-97592673 CAGAGGGAAGACACAGGTGCTGG + Intronic
977531248 4:98202642-98202664 TAGGGGAATGACACAGCAGCAGG + Intergenic
977738609 4:100448600-100448622 CAGGGGAGAGATACAGGTGCTGG - Intronic
978314443 4:107419850-107419872 TAGGGGAATGACACAGCAGCAGG + Intergenic
979619841 4:122786644-122786666 TAGGGGAATGACACAGCATCAGG + Intergenic
980341154 4:131548981-131549003 TAGGGGAATGACACAGCAGCAGG + Intergenic
980438552 4:132812789-132812811 TAGGGGAATGAGACAGCAGCAGG - Intergenic
980439270 4:132818606-132818628 TAGGGGAATGACACAGCAGCAGG - Intergenic
980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG + Intergenic
981857781 4:149315161-149315183 CAGGGGAAGGACCCAGTGGGAGG + Intergenic
982823909 4:159978226-159978248 TAGGGGAACGACACAGCAGCAGG + Intergenic
982885969 4:160783265-160783287 TAGGGGAAAGACACAGCAGCAGG - Intergenic
982889291 4:160826471-160826493 TACGGGAATGACACAGCAGCAGG - Intergenic
983899384 4:173117510-173117532 CATGGGAAGGACACAGTGGGAGG + Intergenic
985480645 5:108132-108154 CAGGGGAGTAAGACATTTGCTGG + Intergenic
986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG + Intronic
986903560 5:12467338-12467360 CAGAGGAAAAACACAGATGCTGG + Intergenic
987269216 5:16288001-16288023 CAGAGAAGTGAAACAGTTGCTGG + Intergenic
988969697 5:36454742-36454764 TAGGGGAACGACACAGCAGCAGG + Intergenic
989108814 5:37887845-37887867 CAGTGCAATGACACAGTCCCAGG - Intergenic
989388607 5:40877666-40877688 CAGGGGAACGACACAGCAGCAGG - Intergenic
990836058 5:60021563-60021585 CAGGAAAATGACACATTTGAGGG + Intronic
993050027 5:82915688-82915710 CAGGAGAATGACACAGCAGTAGG + Intergenic
993054789 5:82969290-82969312 TAGGAGAATGACACAGCAGCAGG - Intergenic
993055578 5:82975764-82975786 TAGGGGAACGACACAGCAGCAGG - Intergenic
994430440 5:99652892-99652914 CGGGGGAATGACACAGCAGCAGG + Intergenic
994622636 5:102180968-102180990 TAGGGGAATGACACAGCAGCAGG - Intergenic
994918237 5:106006406-106006428 CATGAAAATGAGACAGTTGCAGG - Intergenic
995243236 5:109909051-109909073 CATGGGAATGATCCAGTTGATGG - Intergenic
996101383 5:119449109-119449131 TAGGGGAATGACACAGCAGCAGG + Intergenic
997147978 5:131458205-131458227 CAGGGGAAGGACGCAGTGGGAGG + Intronic
997638884 5:135435567-135435589 CAGGGCACTCACACCGTTGCAGG + Intergenic
998552228 5:143088770-143088792 TAGGGGAACGACACAGCGGCAGG - Intronic
998552962 5:143094689-143094711 TAGGGGAATGACATAGCAGCAGG - Intronic
998938323 5:147254628-147254650 TAGGGGAACGACACAGGAGCAGG - Intronic
999316616 5:150588353-150588375 CAGGGTAGTGACAAAGTTCCAGG - Intergenic
999789968 5:154930250-154930272 TAGGGGAACGACACAGCAGCAGG + Intronic
1000628326 5:163564607-163564629 CAGGGGAATTTCGCATTTGCAGG + Intergenic
1001558861 5:172656070-172656092 TAGGGGAACGACACAGCAGCAGG - Intronic
1002505115 5:179673940-179673962 CAAAGAAATGACACAGTAGCTGG + Intergenic
1003255513 6:4471611-4471633 TAGGGGAATGACACAGCAGTAGG + Intergenic
1003299587 6:4865363-4865385 TAGGGGAATGACACAGCAGTAGG + Intronic
1003833233 6:10038029-10038051 CAGAGGAATGAATCAGTTTCCGG - Intronic
1004003068 6:11613566-11613588 CAGGTGTATGACACAGTTTCTGG - Intergenic
1005853898 6:29845722-29845744 TAGGGGAATAACACAGCAGCAGG + Intergenic
1007344032 6:41214866-41214888 TAGGGGAATGACACAGCAGTAGG - Intergenic
1007770130 6:44185617-44185639 TAGGGGAACGACACAGCAGCAGG + Intergenic
1008104932 6:47431048-47431070 TAGGGGAACGACACAGCAGCAGG + Intergenic
1008280202 6:49587375-49587397 TAGGGGAATGACACAGCAGCAGG - Intergenic
1008580095 6:52898870-52898892 TAGGGGAACGACACAGCAGCAGG - Intronic
1008734336 6:54524219-54524241 CAGGGGAAAGACATAGTGACCGG + Intergenic
1009635385 6:66258982-66259004 TAGGGGAATGACACAGCAGCAGG + Intergenic
1010397155 6:75405683-75405705 TAGGGGAACGACACAGCAGCAGG - Intronic
1011450298 6:87484491-87484513 TAGGTGAATGACACAGCAGCAGG - Intronic
1011569955 6:88724921-88724943 TAGGGGAAGGACACAGCAGCAGG + Intronic
1011570610 6:88730381-88730403 TAGGTGAATGACACAGCAGCAGG + Intronic
1013058936 6:106612846-106612868 TAGGGGAATGACAGAGTAGCAGG + Intronic
1013814580 6:114082897-114082919 CAGGGGAACAACACAGCAGCAGG + Intronic
1014471486 6:121820473-121820495 CAGGGGAATGACACAGCAGTAGG + Intergenic
1015351682 6:132226407-132226429 CATGGGAATGACCCAGTGGGAGG + Intergenic
1015521414 6:134135293-134135315 TAGGGGAACGACACAGCAGCAGG - Intergenic
1017133479 6:151128335-151128357 TAGGGGAACGACACAGCAGCAGG + Intergenic
1017844770 6:158247691-158247713 TAGTGGAAAGGCACAGTTGCAGG - Intronic
1018181218 6:161225314-161225336 TAGGGGAAGGACACAGCAGCAGG + Intronic
1018191129 6:161309830-161309852 TAGGAGAATGACACAGCAGCAGG - Intergenic
1018982697 6:168612793-168612815 CAGGCGAAAGACAGAGGTGCAGG + Intronic
1018993419 6:168692126-168692148 CAGGGGACTGAGACTGGTGCAGG + Intergenic
1019618749 7:1979271-1979293 CAGGGGACTGAGACAGCTCCAGG - Intronic
1020655996 7:10928541-10928563 TAGGGGAACGACACAGCAGCAGG + Intergenic
1020745665 7:12075246-12075268 TAGGGGAAAGACACAGTAGTAGG + Intergenic
1021124465 7:16835327-16835349 CACGGGGATGACACAGATGTTGG - Intergenic
1021578650 7:22129068-22129090 CAGGGGAGGGCCACAGATGCTGG + Intronic
1022039658 7:26567953-26567975 CGGGGGAATGACACAGGTTCTGG - Intergenic
1022557197 7:31310339-31310361 CAGAAGAATGACACAGTACCGGG - Intergenic
1023044986 7:36202986-36203008 CAGGGCAAGGACACAGATGCTGG - Intronic
1023436081 7:40141931-40141953 TAGGGGAATGACACAGCAGCGGG - Intronic
1023443737 7:40210692-40210714 TAGGGGAACGACACAGTAGCAGG - Intronic
1023798075 7:43810457-43810479 TAGGGGAATGACACAGCAGCAGG + Intergenic
1023799318 7:43819776-43819798 TAGGGGAACGACACAGCAGCAGG + Intergenic
1023799755 7:43823696-43823718 TAGGGGAACGACACAGCAGCAGG + Intergenic
1024367470 7:48537541-48537563 TAGGGGAATGACACAGCAGTAGG - Intronic
1025861979 7:65338847-65338869 CAGAGGGAGGACACAGATGCTGG + Intergenic
1026206970 7:68266111-68266133 TAGGGGAATGACACAGCAGTAGG + Intergenic
1026799261 7:73388548-73388570 TAGGGGAATGACACAGCAGCAGG - Intergenic
1027713453 7:81638647-81638669 GTGGGGAATGTCACAGTTTCCGG + Intergenic
1028333443 7:89624428-89624450 TAGGGGAATGACACAGCAGCAGG + Intergenic
1029339036 7:99928247-99928269 CAGGGGAGAGACACAGTTTAGGG + Intronic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1030550942 7:110958915-110958937 AATGGGAATGACAGTGTTGCAGG - Intronic
1032004043 7:128285866-128285888 CAGGGAAATGAAACACTTTCTGG - Intergenic
1033092924 7:138403485-138403507 TAGGGGAACGACACAGCGGCAGG + Intergenic
1033096802 7:138439336-138439358 TAGGGGAATGACACAGCAGCAGG - Intergenic
1033464181 7:141576336-141576358 CAAGGGAATGACACAGCAGTAGG - Intronic
1034301453 7:150018776-150018798 CTTGGGAATAACTCAGTTGCTGG + Intergenic
1034804594 7:154078504-154078526 CTTGGGAATAACTCAGTTGCTGG - Intronic
1035289866 7:157831001-157831023 CAGGTAAATGACAGAGTTGCAGG + Intronic
1036104163 8:5822558-5822580 TAGGGGAATGACACAGCAGTAGG - Intergenic
1037763633 8:21758306-21758328 GAGGGGGATGAAACAGTTGAAGG - Intronic
1037814375 8:22103975-22103997 CAGCGGGACTACACAGTTGCTGG + Exonic
1039006096 8:33038788-33038810 CAGGGGAACTACACAGCAGCAGG + Intergenic
1039638767 8:39195122-39195144 CAGAGGGAAGACACAGATGCTGG - Intronic
1040073487 8:43206755-43206777 TAGGGGAATGACAGAGATGGGGG - Intergenic
1040102523 8:43518300-43518322 CAGTGCAAAGACACAGGTGCAGG + Intergenic
1040665050 8:49621669-49621691 TAGGGAAATGACACAGCAGCAGG + Intergenic
1040748940 8:50682223-50682245 TAGGGGAATGACACAGCAGTAGG - Intronic
1041479159 8:58299003-58299025 CAGGGGAACGACACAGCAGCAGG - Intergenic
1042086995 8:65120382-65120404 TAGGGGAAGGACACAGCAGCAGG - Intergenic
1042088484 8:65133196-65133218 TAGGGGAAGGACACAGCAGCAGG - Intergenic
1042415300 8:68511321-68511343 TAGGGGAATGACACAGCAGTAGG - Intronic
1044184306 8:89234096-89234118 TAGGGGAATGATACAGCAGCAGG - Intergenic
1044329234 8:90896944-90896966 TAGGGGAACGACACAGCAGCAGG + Intronic
1047148445 8:122232490-122232512 TAGGGGAATGACACAGCAGTAGG + Intergenic
1047187530 8:122647341-122647363 CAGGCAAATGACAGAGTTGTGGG - Intergenic
1047933475 8:129752408-129752430 CAGAGGAAGGGGACAGTTGCAGG + Intronic
1048388287 8:133934523-133934545 CAGGGGAATGACACAGCAGCAGG + Intergenic
1048692348 8:136981451-136981473 TAGGAGAATGACATATTTGCTGG + Intergenic
1048996107 8:139794593-139794615 CTGGGGGAGCACACAGTTGCTGG - Intronic
1049210801 8:141385653-141385675 CAGGAAAATGACACTGTTTCTGG - Intergenic
1049277962 8:141729371-141729393 CAGGGAAGTGAGACAGGTGCTGG - Intergenic
1050442069 9:5675119-5675141 GAGGGGAACGACACAGCAGCAGG - Intronic
1050475550 9:6036681-6036703 GAGGGGAATGACACACATGAGGG + Intergenic
1051097059 9:13477876-13477898 CAGAGGGATGACACAGATGCTGG - Intergenic
1053111284 9:35461790-35461812 TAGGGGAATGACACAGCAGCAGG - Intergenic
1053246475 9:36538588-36538610 CAGGGGAATGACAGAATTTTTGG - Intergenic
1053588858 9:39490076-39490098 CAGGGGAATTGCAGAGTTACAGG + Intergenic
1054577445 9:66875219-66875241 CAGGGGAATTGCAGAGTTACAGG - Intronic
1056642224 9:88381358-88381380 TAGGGGAATGACACAGCAGCAGG - Intergenic
1056646768 9:88419372-88419394 TAGGGGAATGACACAGCAGCAGG + Intronic
1056656143 9:88510858-88510880 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1056690882 9:88807755-88807777 CAGGAGAATGACAGAGTTTGGGG + Intergenic
1058386745 9:104445188-104445210 CTGGAGAATGACACAGTCCCTGG - Intergenic
1058635903 9:107038474-107038496 CAGGGGAATTACATAGTAGATGG - Intergenic
1060008089 9:120018171-120018193 CAGGGGTATGACTCATTTCCAGG - Intergenic
1060612332 9:124979001-124979023 CAGGGGAATGCCACTGTGCCTGG + Intronic
1061493739 9:130960135-130960157 CAGGGCAAGGTCCCAGTTGCTGG - Intergenic
1061877593 9:133552547-133552569 CAGGGGAATGAAATAGTTTCTGG + Intronic
1186640660 X:11451663-11451685 CAGGGGAGTGACACCTGTGCGGG - Intronic
1187038086 X:15563763-15563785 GAGGGAAATGACACTGTGGCTGG + Intronic
1187921096 X:24202650-24202672 CTGGGGAATGCCACAGTTGAAGG - Intronic
1188743915 X:33817923-33817945 CAGAGGAAAGACACAGGAGCTGG - Intergenic
1189034081 X:37478618-37478640 TAGGGGAATGACACAGCAGCAGG + Intronic
1189034818 X:37484637-37484659 TAGGGGAATGACACAGCAGCAGG + Intronic
1189282529 X:39828846-39828868 CAGGCGAATCACACACCTGCAGG - Intergenic
1189674827 X:43451227-43451249 TAGGGGAATGACACAGTGGTAGG - Intergenic
1189674972 X:43452360-43452382 TAGGGGAATGACACAGTGGTAGG + Intergenic
1189833079 X:44994759-44994781 TAGGGGAACGACACAGCAGCAGG - Intronic
1189834575 X:45006505-45006527 GAGGGGAATGACACAGCAGTAGG - Intronic
1190628658 X:52363513-52363535 CATGGCAATGACACAGAAGCTGG + Intergenic
1191025653 X:55910076-55910098 CAATGGAATGCCACAGTTCCCGG + Intergenic
1191208019 X:57854270-57854292 CAGAGGGAAGACACAGATGCTGG - Intergenic
1191889711 X:65927465-65927487 TAGGGGAATGACACAGCAGCAGG - Intergenic
1193036706 X:76958619-76958641 CAGAGGGAGGACACAGATGCTGG - Intergenic
1193145969 X:78076064-78076086 TAGGGGAATGACACAGCAGCAGG - Intronic
1193584903 X:83309409-83309431 AAGAGGAAAGACACAGATGCTGG - Intergenic
1194058334 X:89164602-89164624 TAGGGGAATGACACAGCAGCAGG - Intergenic
1194493839 X:94584830-94584852 CAGGGGTATGACACTTTTTCTGG + Intergenic
1195110305 X:101641243-101641265 TGGGGGATGGACACAGTTGCAGG + Intergenic
1195846610 X:109236117-109236139 TAGGGGAACGACACAGTAGCAGG - Intergenic
1197141347 X:123121284-123121306 CAGAGGGAAGACACAGATGCTGG + Intergenic
1197213881 X:123850212-123850234 TAGGGGAACGACACAGCAGCAGG + Intergenic
1197526052 X:127564664-127564686 AAGGGGAGTGGCACAGTGGCTGG + Intergenic
1198047838 X:132920292-132920314 CAGGAGATTGACACACTTCCAGG - Intronic
1198948518 X:142042083-142042105 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1199278182 X:145970672-145970694 TAGGGGAATGACACAGCAGCAGG + Intergenic
1199541785 X:148965929-148965951 CAGGAGAGTCCCACAGTTGCTGG + Intronic
1199637198 X:149825334-149825356 TAGGAGAATGACACAGCAGCAGG + Intergenic
1199670740 X:150146301-150146323 CAAGGGAACAACACAGATGCTGG - Intergenic
1200801635 Y:7392515-7392537 CAGGGGAAGGACACAGAAGCAGG + Intergenic
1200802702 Y:7400859-7400881 TAGGGGAAGGACACAGAAGCAGG + Intergenic
1201408221 Y:13671189-13671211 CAGGAGAATGACTCACTTTCAGG - Intergenic
1201474201 Y:14363273-14363295 TAGGGGAATGACACAGCAGCAGG - Intergenic
1201900847 Y:19045162-19045184 CAGGGGAATGACACAGCAGCAGG + Intergenic