ID: 948355242

View in Genome Browser
Species Human (GRCh38)
Location 2:237372504-237372526
Sequence ATCAAAGAGAAGGGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948355238_948355242 0 Left 948355238 2:237372481-237372503 CCTGGGCATTTCAGTGTTTACAC 0: 1
1: 0
2: 0
3: 12
4: 121
Right 948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG 0: 1
1: 0
2: 3
3: 41
4: 430
948355237_948355242 15 Left 948355237 2:237372466-237372488 CCAAGAAGTGGGAGTCCTGGGCA 0: 1
1: 1
2: 2
3: 62
4: 684
Right 948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG 0: 1
1: 0
2: 3
3: 41
4: 430
948355232_948355242 29 Left 948355232 2:237372452-237372474 CCACTGTTAAAAGTCCAAGAAGT 0: 1
1: 0
2: 1
3: 15
4: 180
Right 948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG 0: 1
1: 0
2: 3
3: 41
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948355242 Original CRISPR ATCAAAGAGAAGGGGAGCAA AGG Intronic
901787087 1:11631973-11631995 AAGAAAGAGAAAGGGAGGAAGGG + Intergenic
902783002 1:18716610-18716632 ATCAGGGAGACGGTGAGCAAGGG - Intronic
902853467 1:19180904-19180926 ATGAAAGAGGAGTGGAGGAAGGG - Intronic
903170818 1:21552102-21552124 AGGAAAGGGAAGGGGAGGAAAGG - Intronic
904384405 1:30132078-30132100 AACAATTAGAAGGGGAGAAAGGG - Intergenic
904454714 1:30640655-30640677 CCCAAAGGGAAGTGGAGCAATGG + Intergenic
904777319 1:32918535-32918557 GTTAAAGTGAATGGGAGCAAAGG - Intergenic
905563155 1:38942837-38942859 AGCACACAGAAGGGGAGCACAGG + Intergenic
905799925 1:40836886-40836908 TTAAGAGAGAAGGGGAGGAAAGG + Intronic
906811329 1:48829948-48829970 AAGAGAGAGTAGGGGAGCAAGGG + Intronic
907245010 1:53103062-53103084 ATCCCAGAGGAGGGCAGCAAAGG + Intronic
907368619 1:53982644-53982666 AGCACAGGGAAGGGGAGCAGAGG + Intergenic
907519490 1:55013907-55013929 ATGACAGAGAAGGGGATGAAGGG - Intergenic
907581546 1:55576708-55576730 AACAAAAAGAATGGGAGCAAGGG - Intergenic
907640930 1:56189686-56189708 AGAAAAGAGAAGGGGAGACAGGG - Intergenic
907692838 1:56687442-56687464 ATAAAAGAGGTGGGGAGGAAAGG + Intronic
909645981 1:77918158-77918180 AACAAAGACAAGAGGAACAAAGG + Exonic
910026596 1:82662121-82662143 ATTAGAGGGAAGGGGAGAAAGGG + Intergenic
910225939 1:84936141-84936163 TTCACAGAGAAGGGGAGGGAAGG + Intronic
911310573 1:96287936-96287958 CTGAAAGAGAAGGGGAGAAGGGG - Intergenic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
911456933 1:98136847-98136869 ACGAAAGAGAAAGGGAGAAAGGG - Intergenic
911623114 1:100089956-100089978 AGCAAAAAGAAGGGAAGAAATGG + Intronic
911812543 1:102301571-102301593 ATCAAAGAGAAGGATACAAAGGG - Intergenic
912166990 1:107053671-107053693 ATCAAATAAAAGGGCAGGAAAGG + Intergenic
912924410 1:113901238-113901260 ATTTAAGAGATGGTGAGCAATGG + Exonic
913096393 1:115521175-115521197 AGCAAAGAGCAGGGCAGCAGAGG - Intergenic
913505338 1:119511713-119511735 ATCACAAAGAAGGGCAGGAAGGG + Intronic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
917698642 1:177556573-177556595 GGTAAAGAGCAGGGGAGCAAAGG + Intergenic
918238778 1:182604026-182604048 AGCAAGGGGAAGGGAAGCAAGGG - Intronic
918636572 1:186781827-186781849 ATTACAGAGAATGGGAACAAGGG - Intergenic
919272995 1:195375167-195375189 ATCAAGGGGAAGGGCTGCAATGG - Intergenic
919908127 1:202092339-202092361 AGCAAAGAGATGAGGGGCAAAGG - Intergenic
920040575 1:203092807-203092829 AGCAAAGAGAGGAGGAGAAATGG - Intronic
920377654 1:205517835-205517857 AGAACAGACAAGGGGAGCAAGGG - Intronic
921556601 1:216605967-216605989 AGCAAAGAGAAGGCGAGCAGGGG - Intronic
921809877 1:219500647-219500669 ATGAAAGAAACTGGGAGCAAAGG + Intergenic
923191633 1:231626225-231626247 ACCAAAGAGAAGGGGTGAAGGGG + Intronic
924159924 1:241220517-241220539 AAAAAGGAGAAGGGGAGGAAGGG - Intronic
1062813933 10:485402-485424 ACCCGAGAGAAGGGGAGCAGAGG - Intronic
1063017893 10:2096489-2096511 ATCTGAGAGAAGGGCAGGAAGGG + Intergenic
1063359036 10:5433596-5433618 ATGAAAGAAAAGGTGAGCCATGG - Intronic
1063468261 10:6262764-6262786 CTCAAAGACTAGAGGAGCAAAGG + Intergenic
1064121884 10:12626379-12626401 ATCAAAGAGCTGGGAAGGAACGG - Intronic
1064818707 10:19298485-19298507 AAGAAAGGGAAGGGAAGCAAGGG + Intronic
1064957041 10:20922776-20922798 ATTAAAAGGAAGGGGAGCAACGG - Intronic
1065451949 10:25868584-25868606 ATAATAGAATAGGGGAGCAAAGG - Intergenic
1066236820 10:33493029-33493051 AAAAAAGAGAAGGGAAGCAGTGG - Intergenic
1066656614 10:37703608-37703630 ATTAGAGAGAAGGGCCGCAAGGG + Intergenic
1066773431 10:38865846-38865868 ATCAAATGGAAGGGAAGGAATGG + Intergenic
1067158055 10:43799431-43799453 AGCAAGGAGAAGGGTGGCAAGGG + Intergenic
1067312398 10:45126501-45126523 AACAAAGAGAATGGGGGCAAGGG + Intergenic
1067314106 10:45145161-45145183 ATCAAATAGAGTGGGGGCAAAGG - Intergenic
1067711508 10:48654909-48654931 AACAGAGAGAAAGGGAGAAAGGG - Intronic
1067774918 10:49156378-49156400 ATGAAAGGGAAGGGCAGCATAGG + Intronic
1069448791 10:68499206-68499228 GTCAAAGGGAAGGTGAGTAACGG + Intronic
1069725828 10:70577680-70577702 AAGAAAGAGAAAGGGAGAAAGGG - Intergenic
1070357850 10:75658010-75658032 GCCAGAGAGAAGGGGAGGAAAGG - Intronic
1072726401 10:97816708-97816730 ATCAAAGGGAAGAGGAGACAAGG - Intergenic
1073841997 10:107508377-107508399 ATCAATGAGAAATAGAGCAAGGG - Intergenic
1074548142 10:114417883-114417905 AAGAAAGAGAAGGGGAGGAGAGG + Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1074846631 10:117404522-117404544 ATTGAAGAGATGGGGAGGAAGGG + Intergenic
1075238730 10:120757965-120757987 ATCAGAGAGAAGGAAAGAAAGGG + Intergenic
1075624525 10:123952147-123952169 TTCAAAGTCAAGGGGAGAAAAGG + Intergenic
1075760226 10:124849821-124849843 ACAAAAGAGAAGGGGAGTGAAGG - Intergenic
1075982082 10:126748758-126748780 ATCAACTAGAAGGGGAGCTGTGG - Intergenic
1076150071 10:128154684-128154706 ATCAAAGAGACAGCTAGCAATGG - Intergenic
1077992340 11:7423192-7423214 TTCAAAGAGACAGGAAGCAACGG - Intronic
1078151895 11:8766530-8766552 TCCAAAGAGACAGGGAGCAATGG + Intronic
1079754976 11:24246514-24246536 ATCAAGGAGAAAGAGACCAAGGG - Intergenic
1081743189 11:45455235-45455257 AGAAATGAGAAGGGGAGTAAGGG - Intergenic
1083020038 11:59497269-59497291 ATCAAAAACAAGGGAAACAATGG + Intergenic
1083062876 11:59892480-59892502 AACAAATAGAAGTGGAGCAGAGG - Intergenic
1083670349 11:64296754-64296776 ACCAAAGGGAAGGGGAGAACAGG + Intronic
1083786095 11:64948417-64948439 AGAAAAGAAAAGGGGTGCAAAGG - Intronic
1084734397 11:71094969-71094991 CTCAGAGGGAAGGGCAGCAAGGG - Intronic
1086092058 11:83014780-83014802 AAGAAAGAGAAGGGGAGGGAGGG + Intronic
1086374229 11:86184007-86184029 AACAGTGAGGAGGGGAGCAAGGG + Intergenic
1086960747 11:92978141-92978163 AGCACAGAGGAGGGGGGCAAGGG + Intronic
1087805894 11:102555057-102555079 ATCAGAGAGACAGGGAGGAAGGG - Intergenic
1087845855 11:102971617-102971639 AAGAAAGAGGAAGGGAGCAAGGG + Intergenic
1088968749 11:114752470-114752492 AACAGAGAGTAGGAGAGCAAGGG + Intergenic
1089119075 11:116119104-116119126 ATCAGGGAGAAGGGAAGGAAAGG - Intergenic
1089498113 11:118917994-118918016 ATGAAAGAGATGGGGAGCATTGG - Intronic
1090070602 11:123541555-123541577 GTCAACAAGAAAGGGAGCAAAGG - Intronic
1090107830 11:123870595-123870617 AGCAAAGAGCAGGAGAGCAGGGG + Intergenic
1090522701 11:127496174-127496196 ATCAGAGAGAAGGAGAGACAGGG + Intergenic
1090810934 11:130242141-130242163 AACAAATAGAAGGGGAGAAATGG - Intronic
1091181089 11:133605386-133605408 ATGAAAGAGAAAGGGAGGGAAGG - Intergenic
1091402487 12:189358-189380 GGGAAAGAGAAGGAGAGCAACGG - Intergenic
1091618973 12:2071221-2071243 GTCAAAGGAAAGGGAAGCAAAGG - Intronic
1092240968 12:6836461-6836483 ATCAAGGAGTGGGGGAGCCACGG + Intronic
1092711552 12:11343099-11343121 TGCAAAGAGCAGTGGAGCAAAGG - Intergenic
1092948213 12:13476114-13476136 ATCAGAGAGAAGCGGAGGCAGGG + Intergenic
1093683791 12:22032836-22032858 AGGAAAGAGAAGGGAAGGAAAGG + Intergenic
1096000241 12:48123333-48123355 ATGAAAGGGAAGAGGAGGAAAGG - Intronic
1096807712 12:54150564-54150586 AACCAAGAAAAGGGGAGCCAAGG - Intergenic
1096828790 12:54299058-54299080 AAAAAAAAGAAGGGGAGCAAGGG + Intronic
1097342447 12:58454413-58454435 ATGGAAGGGAAGGGGAGGAAAGG - Intergenic
1098019404 12:66136704-66136726 ATCAAAGAGAAAGGCCTCAAAGG + Intronic
1098361275 12:69656767-69656789 ATCAAAGGGATTAGGAGCAAGGG - Intronic
1099832896 12:87867957-87867979 ATCACAGACAAGGGGAGCCCAGG + Intergenic
1101059886 12:100959756-100959778 ACAGAAGAGAAGGTGAGCAAAGG - Intronic
1101090570 12:101280607-101280629 ATAAAAGAGCAGGGGAGAATTGG - Intronic
1101509643 12:105381124-105381146 CTGGAAGAGAAGGGGAGCACTGG - Intronic
1101700466 12:107169097-107169119 ATAAAATATAAGTGGAGCAAAGG + Intergenic
1103031425 12:117616726-117616748 ATCAACAACAAGGGGAGTAAAGG - Intronic
1103196288 12:119046188-119046210 AGCAGAGTGAAGGGGAGCAGTGG + Intronic
1103285920 12:119801688-119801710 ATCAAAGAGCAGGGCAGAAGCGG - Intronic
1104332097 12:127856506-127856528 GAGAAAGAGAAGGGGAGCAAGGG - Intergenic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106212130 13:27659345-27659367 ACCAATGAGGAGGGGAGCAAGGG + Intronic
1106747960 13:32723996-32724018 TTCAAATATAAGAGGAGCAAGGG - Intronic
1107507558 13:41049667-41049689 ATGTAAGAGAAAGGGAGAAAAGG - Intronic
1107598187 13:41985606-41985628 ATAAAGGAGGAGGGGACCAAGGG - Intergenic
1109147127 13:58792934-58792956 ATCAAAAAGAATTAGAGCAAAGG - Intergenic
1109718038 13:66242777-66242799 ATCAAGGAGAAGGGCAGCCAGGG - Intergenic
1109860270 13:68189438-68189460 AGGATAGAGAAGGAGAGCAAAGG + Intergenic
1110426561 13:75373854-75373876 ATGCAAGAGAAGGGGAGGGAAGG - Intronic
1110621234 13:77598318-77598340 ATCAAAGAGAAGGAGAAAACAGG + Intronic
1110903301 13:80852527-80852549 ATCAAAGACAAGGGCAGAACTGG - Intergenic
1111085665 13:83372654-83372676 AGCAAAGAGACGGGCAGCATTGG - Intergenic
1111106977 13:83658645-83658667 ACCAAAGAGAAAGAGAGAAATGG - Intergenic
1111939119 13:94590600-94590622 AGGATAGTGAAGGGGAGCAACGG - Intronic
1113780099 13:112971791-112971813 ATCACATAGAAGGGGGGCCAGGG - Intronic
1114034639 14:18611443-18611465 ATCAAAGAAAACAGGAGGAAGGG - Intergenic
1114124006 14:19703573-19703595 ATCAAAGAAAACAGGAGGAAGGG + Intergenic
1114639467 14:24209660-24209682 ATCAAAGAGAAGGGAGCCCAAGG + Exonic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1115438636 14:33406314-33406336 GTAAAAGAGATGGGGAGAAAAGG + Intronic
1115784314 14:36806999-36807021 AACAAAAAGAAGGGGAGTGAAGG + Intronic
1115891909 14:38040300-38040322 AATGAAGAGAAGGGGAGAAAGGG + Intronic
1116561578 14:46385997-46386019 ATGAAAGAGAAGGGAAGGGATGG + Intergenic
1117186951 14:53249557-53249579 GTCAAAGAGAGGGTGAGGAAGGG + Intergenic
1117207600 14:53460180-53460202 AAGGAAGAGAAAGGGAGCAAGGG + Intergenic
1118657702 14:67969913-67969935 ATCAAAGTGAATGGGAGCTTTGG + Intronic
1120931580 14:89854394-89854416 CTGAATGAGGAGGGGAGCAATGG - Intronic
1121038884 14:90728806-90728828 GTCAGAGAGAAGGAGGGCAAGGG + Intronic
1122048998 14:99042618-99042640 ATCATGGAGCAGGGGAGCAAGGG + Intergenic
1122243679 14:100385690-100385712 TTCACAGACAAGGGGAGGAAGGG - Intronic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1124495062 15:30181320-30181342 ACTCAAGAGAAGGGGAGCCAGGG + Intergenic
1124748507 15:32357325-32357347 ACTCAAGAGAAGGGGAGCCAGGG - Intergenic
1124865484 15:33486649-33486671 ATCAAAGAGGAGGGGAGTAGAGG + Intronic
1125076651 15:35626932-35626954 CTCAAAGAGAAGAGGAGGAATGG - Intergenic
1125778076 15:42236422-42236444 ATGAAAAAGAAGGGAAGAAATGG + Intronic
1125818365 15:42606266-42606288 AGCACAGAGAAGGAGTGCAAAGG - Intronic
1126459223 15:48897255-48897277 ATGAGAGAGAAGGGGAGAAGTGG + Intronic
1127290751 15:57568700-57568722 ATCACAGGGAAATGGAGCAATGG - Intergenic
1127470085 15:59282841-59282863 AAGAAAGAGAAGGGAAGGAAAGG + Intronic
1131394058 15:92072742-92072764 AAAAGAGAGAAGGGGAGCAGAGG - Intronic
1131791872 15:95973938-95973960 ATCAGAAAGAAGGGGAAAAAGGG - Intergenic
1132890569 16:2202370-2202392 AGGAAGGAGAAGTGGAGCAAAGG + Intergenic
1135168753 16:20164646-20164668 AGGAGAGAGAAGGGGAGAAACGG - Intergenic
1135342088 16:21657648-21657670 ATCTCAGAGAAGGGGAGGAAAGG + Intergenic
1135621581 16:23960395-23960417 ACCATAGAGTAGGGGAGAAAGGG - Intronic
1135862244 16:26067360-26067382 CTAGCAGAGAAGGGGAGCAATGG - Intronic
1136282740 16:29223378-29223400 ACAGAGGAGAAGGGGAGCAAAGG + Intergenic
1137319529 16:47366409-47366431 ATCAATGAGAAGAGAAGCAAAGG + Intronic
1138450131 16:57088823-57088845 TTTACAGAGAAGGAGAGCAAGGG + Intergenic
1139085330 16:63577983-63578005 ATCAAAGAAAGGGGGAGGAGTGG - Intergenic
1140928336 16:79603221-79603243 GTTAAAGAGAAGGAAAGCAAGGG - Intergenic
1141349976 16:83285888-83285910 ATCACAGAGAAGTGGGACAAGGG + Intronic
1142087118 16:88189301-88189323 ACAAAGGAGAAGGGGAGCAAAGG + Intergenic
1142654295 17:1380909-1380931 ATTGTAGAGAAGGGGAACAAGGG - Intronic
1142765201 17:2060585-2060607 ATCAACTAGAAGGGGAAGAAGGG + Exonic
1142883957 17:2901301-2901323 TTCAAAGAGAAGGGTGGCAAGGG - Intronic
1144694683 17:17294816-17294838 AAAAAAGAGAAGGGGAGGGAAGG - Intergenic
1146034251 17:29391353-29391375 ACAAAGGAGAAGAGGAGCAAAGG - Intronic
1146859612 17:36285780-36285802 AGCAAGGAAAAGGGGAGAAAAGG - Intronic
1147089936 17:38089867-38089889 AGCAAGGAAAAGGGGAGAAAAGG - Intergenic
1147107275 17:38230654-38230676 AGCAAGGAAAAGGGGAGAAAAGG + Intergenic
1147464363 17:40599352-40599374 GTCACAGAGCAGGGGAGAAAGGG + Intergenic
1148057980 17:44813061-44813083 AAAAAAGAGAAAGGGAGGAAAGG - Intronic
1148293493 17:46478130-46478152 ATCAAAGAGAAGGTGGGTAGTGG - Intergenic
1148315679 17:46695832-46695854 ATCAAAGAGAAGGTGGGTAGTGG - Intronic
1149789956 17:59468178-59468200 AACAAAGAGAAGAGTAGCATGGG - Intergenic
1150374667 17:64671021-64671043 GGGAAAGAGAAAGGGAGCAAAGG - Intergenic
1151594334 17:75067869-75067891 ATTCAAGAGGAGGGGACCAATGG + Intergenic
1153026793 18:679832-679854 AGCAAAGGGAAGGGAAGCCAGGG - Intronic
1153042871 18:830468-830490 ACCAAAGACAAGGGGAGCTGGGG + Intergenic
1153719655 18:7888962-7888984 TACAAAAAGGAGGGGAGCAAGGG + Intronic
1156907426 18:42370567-42370589 ATGATAGAGAATGGGAGCCAAGG + Intergenic
1157561289 18:48648246-48648268 TTCAAAGAAAAAGGGAGCATGGG + Intronic
1158795223 18:60837933-60837955 AACAGAGAGGAGGAGAGCAAAGG - Intergenic
1158899278 18:61947739-61947761 ATCACAGTGAAGCAGAGCAAAGG - Intergenic
1159150693 18:64519513-64519535 ATTAAAGAGAATGGAAGAAAGGG - Intergenic
1159292964 18:66446056-66446078 AAGAAAGAGAAGGGAAGGAAGGG - Intergenic
1160316259 18:77850453-77850475 AACCAAGAGAAAGGGAGCTAGGG - Intergenic
1161797396 19:6395011-6395033 GACAAAGAGAAGGGGAGTATGGG + Intergenic
1161797416 19:6395077-6395099 AACAGAGAGAAGGGGAGTATGGG + Intergenic
1162325546 19:9996890-9996912 GACAAAGAGAAGGGGAGAGAGGG + Intronic
1162991599 19:14306401-14306423 AGAAAAGAGAAGGGGAGGGAAGG - Intergenic
1165139505 19:33690314-33690336 ATGAAAGAGAAGGGGGCCAGAGG + Intronic
1166297702 19:41897055-41897077 TTGAAAGAGAAGGGGAGGAAGGG - Intronic
1166536830 19:43579971-43579993 ATGGAGGAGAAAGGGAGCAATGG + Intronic
1167197915 19:48043632-48043654 AGCAAAGAGAAGGAGAGAAAAGG - Intronic
1167495033 19:49812720-49812742 ATGACAGAGAACGGGAGCTAAGG + Exonic
926920757 2:17937460-17937482 ATCAAGGAGGAGGGGAGCCAAGG - Intronic
927109469 2:19853876-19853898 ATCATAGAGAAGGGGAGAAAGGG + Intergenic
927649049 2:24899838-24899860 ACCTATGAGAAGGGGAGCAAGGG + Intronic
928133668 2:28672013-28672035 ATCAAAGGAAAGGGGAACTAAGG + Intergenic
928393964 2:30930143-30930165 ATCAAAGAAATAGGGAGAAAAGG + Intronic
929716952 2:44321965-44321987 CTCAAAGAAGAGGGGAGGAATGG - Intronic
930542910 2:52730026-52730048 TTCAAGGAGAAAGGGAGCTAGGG + Intergenic
931230861 2:60373219-60373241 AGGAAAGAGAGGGGGAGGAAAGG + Intergenic
931453060 2:62384854-62384876 AACAAAGAGATGGGTATCAATGG - Intergenic
931570859 2:63667982-63668004 AACAAAGAGAACTGGAGAAAGGG - Intronic
931778142 2:65557283-65557305 ATAAAAGAGAAGAGGAGGAGAGG - Intergenic
932421070 2:71601712-71601734 TTCGCAGAGAAGGGCAGCAAAGG - Intronic
933093134 2:78146094-78146116 AACAAAGTGAAGGGGAGCCCTGG + Intergenic
933611983 2:84445772-84445794 ATTAGATTGAAGGGGAGCAAGGG - Intronic
935578827 2:104737885-104737907 GTCAAAGAGAAGAGAAGCAAAGG - Intergenic
936238542 2:110767392-110767414 TGCAAAGAGAGGGGGAGGAAAGG + Intronic
936687932 2:114850032-114850054 AAGAAAGAGAAGGGAAGAAAAGG - Intronic
937008755 2:118542872-118542894 ACCAAAGGGCAGGGGTGCAAGGG - Intergenic
937153884 2:119704603-119704625 ATAAAGAAGAAGGGGAGGAAAGG + Intergenic
937632271 2:124116415-124116437 ATCAAAGAGAAGGGAAGAGATGG + Intronic
937868835 2:126773250-126773272 ATCACAGAACTGGGGAGCAAAGG + Intergenic
937872498 2:126796219-126796241 AACACAGAGAAAGGCAGCAAAGG - Intergenic
938327581 2:130422164-130422186 ATCAAAGAAAACAGGAGGAAGGG + Intergenic
938438756 2:131305954-131305976 ATCAAAGACAACAGGAGGAAGGG - Intronic
938601713 2:132849233-132849255 TTCAAAAAGAGGGGGAGCCATGG - Intronic
939084231 2:137697884-137697906 AGCAAAGAGAAGAGTGGCAAGGG - Intergenic
939521904 2:143241910-143241932 TTCAAAGAGACGGAGAGAAAAGG + Intronic
939574567 2:143880771-143880793 ACCGAAAAGAAGGGGGGCAATGG + Intergenic
940179704 2:150918498-150918520 AGGAAAGGGAAGGGGAGGAAGGG + Intergenic
941215158 2:162697560-162697582 AGGAAAGAGAAGGGAAGGAAGGG + Intronic
942233170 2:173878492-173878514 ATGACAGAGAAGGGGAGAAGGGG + Intergenic
942357780 2:175137703-175137725 ATTAAGGAGAAGGGTACCAAGGG - Intronic
943218388 2:185070445-185070467 ATCAAAGAGAAGAGCATCATGGG + Intergenic
943367728 2:186981734-186981756 AAGAAAGGGCAGGGGAGCAATGG - Intergenic
944486598 2:200213348-200213370 AGGAAAGAGGAAGGGAGCAAGGG - Intergenic
944517608 2:200527862-200527884 ATAAAACAGAAGGGGAGAATGGG + Intronic
945249888 2:207756486-207756508 ATCAAAGAGAAAGGAATTAAAGG + Intronic
945422285 2:209653378-209653400 ACCAAAGAGAATGGGATCAACGG + Exonic
947321496 2:228924555-228924577 ATCAAGCAGAATAGGAGCAAAGG - Intronic
947635128 2:231676563-231676585 CTCAGAGAGAAGGGGAAGAAAGG + Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1169024076 20:2352482-2352504 ATCAAAGAGATAGGGCTCAATGG + Intergenic
1169076679 20:2764267-2764289 AGTGAAGAGAAGGGGAGCATGGG - Intergenic
1170356422 20:15496976-15496998 ATCAATGGGAAAGGGAGGAAAGG + Intronic
1171161546 20:22929106-22929128 ATCAAATAGAAAGGGAAAAATGG - Intergenic
1171780577 20:29413626-29413648 AACAGAGAGAAAGGGAGGAATGG - Intergenic
1172110113 20:32539595-32539617 AACAAAGAGAAGAGGAGCGATGG - Intronic
1172644794 20:36462479-36462501 AGCAGAGAGAAGGGGAGACAGGG - Intronic
1172992067 20:39044026-39044048 AATGAAGAGAAGGGGGGCAAAGG - Intergenic
1173535013 20:43802871-43802893 ATCAGAGAGGAGGGAAGAAATGG - Intergenic
1173598289 20:44274420-44274442 TTCAAAGAGAAAGGGAGGAGAGG - Intronic
1173670650 20:44796430-44796452 AGGAGAGAGAAGGGGAGGAAGGG + Intronic
1174088323 20:48026376-48026398 GTCAAAGGGAAGGGAAGGAAAGG - Intergenic
1174290183 20:49502845-49502867 ATAAAAAAGAAGGGGTGAAATGG - Intergenic
1174518705 20:51113325-51113347 AAGAGAGAGAAGGGGAGAAAGGG - Intergenic
1175476276 20:59276925-59276947 ATCAAAGAGAGGAGAAGAAAGGG + Intergenic
1178429005 21:32502755-32502777 AAGAAAGAGAAGAGGAGCTAAGG - Intronic
1178713650 21:34943491-34943513 AAGAAAGATAAGGGGATCAACGG + Intronic
1179244751 21:39623141-39623163 AAGAAAGAGAAAGGGAGGAAGGG - Intronic
1179272523 21:39862388-39862410 ATCAAAGAGAGGGGCTGCAGAGG + Intergenic
1179435915 21:41361999-41362021 ATAAAAGTGAAGTGGAGGAAAGG + Exonic
1180353681 22:11822913-11822935 ACCACAGAGAAGGGGAGCCTGGG - Intergenic
1182277806 22:29201503-29201525 ATGAAAGAGAAGCAGAGGAAGGG + Intergenic
1182386753 22:29949574-29949596 ATCAATGAGACAGGCAGCAAAGG - Intronic
1183305635 22:37081642-37081664 AACAGAGAGAGGGGGAGCTATGG + Intronic
949349458 3:3110763-3110785 ATCAAACAGAAATGGAACAAAGG - Intronic
950856173 3:16107479-16107501 ATGAGAGAGAATGGGAGCAGAGG - Intergenic
951632129 3:24733808-24733830 ATCAAAGTGAAGTAGAGGAAAGG - Intergenic
952414753 3:33080752-33080774 ATCCAAGAGCATAGGAGCAAGGG - Intronic
953853388 3:46482817-46482839 AAGAAAGAGAAAGGGAGGAAGGG + Intronic
953983976 3:47427384-47427406 ATCAAAAAGACGGTGACCAATGG + Intronic
954062324 3:48078561-48078583 ATCAAAGAGTAGGGTAGAAAGGG + Intronic
955067024 3:55542689-55542711 GTCAATGAGAAGGGGAGAAAGGG - Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
956538545 3:70307562-70307584 ATCAAAGAGAAGGAGAAAATAGG - Intergenic
956585759 3:70862824-70862846 ATGAAAGAATAGGGGAGAAAAGG + Intergenic
957084439 3:75667642-75667664 AACAGAGAGAAAGGGAGGAATGG + Intergenic
958648380 3:96902737-96902759 ATTAAAAGGAAGGGGAGAAAAGG - Intronic
958857940 3:99409338-99409360 ATGGAAGTGAAGGGGAGAAAAGG + Intergenic
958945265 3:100354923-100354945 ATCAATGAGAAGGGGCATAAAGG - Intronic
959667448 3:108937354-108937376 AGCAAACAGAGAGGGAGCAACGG - Intronic
960946716 3:122971882-122971904 TTCAAAGAGAAGGGAGGCAGCGG - Intronic
961879286 3:130049428-130049450 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
962047331 3:131774651-131774673 ACCAAAGAGAAGGACTGCAAGGG - Intronic
962730133 3:138274117-138274139 ATTAAAGAAAAAGGAAGCAAAGG - Intronic
963179250 3:142336615-142336637 GGAAAAGAGAAGGGGAGGAAGGG + Intronic
963950661 3:151196493-151196515 ACCAAAGAGAAGAGGACTAAAGG + Intronic
964609693 3:158598774-158598796 ATCTCTGAGAAGGGGAGAAAGGG - Intronic
966473193 3:180315639-180315661 TTCCAAGAGAAGGGAAGAAAGGG + Intergenic
966755313 3:183364655-183364677 AAAAAAGAGAAGGGGAGGAAGGG + Intronic
966826177 3:183966872-183966894 ATGAAACAGAGGGGGAGCAGGGG - Intronic
968986151 4:3875581-3875603 AGCAAGGAGTAGGGCAGCAAAGG - Intergenic
968991515 4:3916449-3916471 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
969502995 4:7565074-7565096 CTCAGAGGGAGGGGGAGCAAGGG + Intronic
969820683 4:9717926-9717948 ATAAAAGAGATGGAGAGGAAGGG - Intergenic
971448551 4:26778431-26778453 AGGAAAGAGAAGGGGAGGGAAGG + Intergenic
972351949 4:38244247-38244269 AAAAAAGAGAAGTGGAGGAAGGG - Intergenic
972654382 4:41050732-41050754 AGGAAAGAGAAAGGGAGAAATGG + Intronic
972924647 4:43987989-43988011 AAAAAAGAGCAGGGGAGCAGGGG + Intergenic
973893112 4:55387542-55387564 CTCAGAGAGAAGGGGAGCACAGG + Intergenic
976129252 4:81867288-81867310 ATAAAAGAGAAGGGGGGAATGGG + Intronic
978460563 4:108947141-108947163 ATAAAATAGAAGGTGAGAAATGG + Intronic
980264630 4:130499391-130499413 ATAAAAGAAAAAGGGAGGAAAGG - Intergenic
980343787 4:131584908-131584930 ATCAAAGAAAAGGGGTGTAAGGG - Intergenic
981529739 4:145740907-145740929 ATCAGATAGAATGGGAGGAAAGG - Intronic
982404587 4:155005780-155005802 AACAAAGAGAAGGGGAGGAATGG + Intergenic
983115401 4:163809448-163809470 ACCAAAGAGATGGGCAGAAATGG - Intronic
984511965 4:180689881-180689903 ATTAAAGAGGAGGGAAGGAATGG + Intergenic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
986232221 5:5876754-5876776 GTGAGAGAGAAGGGGAGCAAGGG + Intergenic
986618065 5:9640194-9640216 CTCAAGGAGAAGGAGTGCAATGG + Intronic
987472146 5:18345353-18345375 ATGAGAGAGAAGGAGAGGAAGGG + Intergenic
988638764 5:33017683-33017705 ATCTCACAGAAGAGGAGCAAAGG + Intergenic
989166994 5:38441832-38441854 AACACAGGGAAGGGAAGCAAGGG - Intronic
991329285 5:65475956-65475978 AATTAAGAGGAGGGGAGCAAGGG - Intronic
993434691 5:87877630-87877652 GGCAAAGAGAAGGAGAGAAAGGG + Intergenic
993918387 5:93770035-93770057 ATCAGTTAGTAGGGGAGCAAGGG + Intronic
994688650 5:102988645-102988667 AGGAAAGGGAAGGGGAGGAAAGG + Intronic
995001932 5:107143745-107143767 ATCACAGAGAAGATAAGCAAAGG - Intergenic
995462063 5:112413926-112413948 AACAAGGAGAAGAGGAGGAAAGG + Intronic
995849144 5:116526126-116526148 ATAAAAAAGAAGGGGGGAAAAGG - Intronic
996398288 5:123034805-123034827 ATCATTGAAATGGGGAGCAAGGG - Intronic
996408465 5:123130040-123130062 AGGAAAGAGAAGGGAAGGAAAGG - Intronic
996644783 5:125800241-125800263 GTGATAGGGAAGGGGAGCAATGG + Intergenic
996707930 5:126515618-126515640 AGAAAAGGGAAGGGGAGAAAGGG - Intergenic
996879424 5:128278070-128278092 ATCAAAGAGAAATGAAGAAATGG + Intronic
997084058 5:130775407-130775429 CTCAAGGAGAAGGGAAGAAATGG + Intergenic
997507500 5:134429490-134429512 ATCAGAGAGAAAGGGAGGTAGGG + Intergenic
998047022 5:138996188-138996210 ATCAAAGAGACAGGGAATAATGG - Intronic
998106490 5:139472300-139472322 ATCAAAGAAAAAGGCAGAAAAGG - Intergenic
998129541 5:139644393-139644415 ATCACAAAGGATGGGAGCAAAGG - Intergenic
998676270 5:144412005-144412027 ATCAAAAAGACAGGGAGTAATGG + Intronic
998794204 5:145800283-145800305 GTGTAAGAGAAGGGGAGGAAAGG - Intronic
999378786 5:151105450-151105472 AGCATGGGGAAGGGGAGCAAAGG - Intronic
999426396 5:151490949-151490971 ATCACAGAGCAACGGAGCAAAGG + Exonic
999714938 5:154352992-154353014 ATCAGAGAGGAGGGGAGAAGAGG - Intronic
1000252021 5:159504878-159504900 AACAAGGAGAAAGGAAGCAACGG - Intergenic
1000260016 5:159578734-159578756 ATCAACCAGATGGGGAGCCATGG + Intergenic
1000390478 5:160718018-160718040 ATCAAGGAGAAAGCAAGCAAGGG + Intronic
1000578546 5:163007387-163007409 ATCACAGAGAAAGAAAGCAAAGG - Intergenic
1001198671 5:169696205-169696227 TTCACAGAGCTGGGGAGCAAAGG - Intronic
1001469414 5:171999554-171999576 TTCAAAGAGAAAGGGGGCAGAGG - Intronic
1003475811 6:6481696-6481718 ATGAAAGAGAAGAGAAGAAAAGG + Intergenic
1003492482 6:6635768-6635790 ATCCACGAGAAGAGGAGCCAAGG - Intronic
1003789187 6:9523788-9523810 AGCACAGAGATGGGGAGTAAAGG + Intergenic
1005187654 6:23180986-23181008 GAAAGAGAGAAGGGGAGCAAGGG + Intergenic
1006423995 6:33952391-33952413 ATCAAAGAGAAGGGACTCAGAGG + Intergenic
1007060904 6:38940153-38940175 ATCAAAGAAAAGAGGTTCAAGGG + Intronic
1007595161 6:43046615-43046637 ATCAGAGAGAAGGGGCACAGGGG + Intronic
1008338791 6:50339228-50339250 AACAAGGAGAAGAGGAGTAAAGG - Intergenic
1008548641 6:52605905-52605927 AACAAAGGGGAGGGGAACAAAGG - Intergenic
1008548647 6:52605920-52605942 AACAAAGGGGAGGGGAACAAAGG - Intergenic
1008548653 6:52605935-52605957 AACAAAGGGGAGGGGAACAAAGG - Intergenic
1008548659 6:52605950-52605972 AACAAAGGGGAGGGGAACAAAGG - Intergenic
1008548665 6:52605965-52605987 AACAAAGGGGAGGGGAACAAAGG - Intergenic
1009380260 6:63019195-63019217 CTCAAAGAGAGAGGGAGAAAGGG + Intergenic
1009564433 6:65294022-65294044 ATCAAATGGAAAGGGAGAAAGGG + Intronic
1010784390 6:79983381-79983403 ATTAAATAGAAGGCGAGGAATGG - Intergenic
1011063758 6:83301233-83301255 AAGAAAGAGAAAGGAAGCAAGGG - Intronic
1011302528 6:85891786-85891808 ATCAAAGACAAAGGCTGCAAAGG - Intergenic
1012459534 6:99445020-99445042 GTCAGAGAGAAGTGGAGAAAGGG - Intronic
1012867811 6:104639028-104639050 ATGAAAGTGAAGGGCAGGAAGGG + Intergenic
1013046066 6:106487043-106487065 AACAAAGAGAAAGGAAACAAAGG - Intergenic
1014384927 6:120788362-120788384 AAGAAAGAGAAAGGGAGCTATGG - Intergenic
1014900440 6:126957273-126957295 ATCACAGAGAAGTGAAACAAAGG - Intergenic
1015408057 6:132859528-132859550 ATCAAAGAAAGGGGAAGCTAAGG + Intergenic
1015812144 6:137171505-137171527 TTCAAAGAGAAAGGGAAGAATGG + Intronic
1015975088 6:138782142-138782164 AACATAGAGTAGGGGAGGAAAGG - Intronic
1016494695 6:144647437-144647459 ATCAAGGAGACTGGGACCAAAGG + Intronic
1017643027 6:156512856-156512878 TTCCAGGAGAAGGGGAGCCAAGG - Intergenic
1018508279 6:164494749-164494771 GGGAAAGAGACGGGGAGCAAAGG - Intergenic
1019324921 7:433363-433385 ATGCAAGATAAGGGGGGCAAAGG - Intergenic
1019953778 7:4395427-4395449 AGGAAAGAGAAGCGGAGCACAGG - Intergenic
1020314347 7:6894338-6894360 AAGAAAGAGAAGTGGAGCTAAGG + Intergenic
1020836487 7:13158828-13158850 AAAAAAGGAAAGGGGAGCAAAGG - Intergenic
1020852605 7:13376467-13376489 CTCAAAGAGAGGGGGATTAATGG + Intergenic
1020941181 7:14539737-14539759 AACAATGTGAAGGTGAGCAAAGG - Intronic
1020984809 7:15120188-15120210 TTCAAAGAGAATGGGAGAAAAGG - Intergenic
1021170093 7:17389154-17389176 ATTATAGATAAGGGAAGCAAGGG - Intergenic
1021474452 7:21044599-21044621 ATAAAAGAGAAGGTGAGATAGGG + Intergenic
1021644750 7:22778096-22778118 ATGAAAGAGAAAAGGAGCTAAGG + Intergenic
1022815995 7:33914747-33914769 ATCTAAGAGAAGGATAGAAAAGG + Intronic
1023638915 7:42238361-42238383 AACAAGGAGATGGGGAGCCAAGG - Intergenic
1025030094 7:55549853-55549875 CTCATGGAGGAGGGGAGCAATGG - Intronic
1026092079 7:67308705-67308727 ATCAAAAAGAAGGGGATAATAGG - Intergenic
1027146234 7:75696596-75696618 AGAAAAGGGAAGGGGAGCAGAGG - Intronic
1027998761 7:85464099-85464121 ATCAAAGAAAAGGAGATCCAAGG - Intergenic
1028121118 7:87058115-87058137 ATGAAAGAGAATCGGATCAAAGG - Intronic
1028187746 7:87808204-87808226 ATCAAACAGAAGGGGATGAGAGG - Intronic
1028244700 7:88462936-88462958 ATCACAGGGAGGGGGAGGAAAGG - Intergenic
1028529903 7:91827083-91827105 TTTAAAGAGAAAGGAAGCAAAGG - Intronic
1028697379 7:93730833-93730855 CACAAAGAGAAAGGGGGCAATGG + Intronic
1029377508 7:100188582-100188604 ATCAAAAAGAAGGGGATAATAGG - Intronic
1030781432 7:113605404-113605426 AACACAGAGCAGGGGAGAAAGGG + Intergenic
1032826504 7:135574592-135574614 ATAAATGAGAGGGAGAGCAAAGG + Intronic
1033017615 7:137687876-137687898 ATCAAAGAAAAGGGGAGAAGAGG + Intronic
1033519361 7:142145410-142145432 ATCAGAGAGAGAGGGAGGAAGGG - Intronic
1034321251 7:150184821-150184843 ATCACAGAGAAAGAGAGCAGTGG - Intergenic
1034529287 7:151685322-151685344 CTCAAAGAGAAGCTGAGCATGGG - Intronic
1034771499 7:153782443-153782465 ATCACAGAGAAAGAGAGCAGCGG + Intergenic
1035606994 8:936257-936279 AAGAAAGAGAAGGGGACCCAAGG + Intergenic
1037809721 8:22080346-22080368 CCCAAAGTGAAGGGGACCAAAGG + Intronic
1038715885 8:29990752-29990774 AAGAAAGAGAAGGGGAGCAAAGG - Intergenic
1039683866 8:39774997-39775019 AAGAAAGAGAGGGGGAGGAAAGG + Intronic
1040703053 8:50090637-50090659 ATCTGAGAGAAGGGGAGCACTGG - Intronic
1041091094 8:54301467-54301489 ACAAATGAGAAGGGGAGAAAGGG - Intergenic
1041157186 8:55000227-55000249 ATGAAAGAAAAGACGAGCAATGG - Intergenic
1041674315 8:60522685-60522707 ATACAAGAGAAGGGGAGGTAAGG + Intronic
1041960852 8:63613975-63613997 AGAAAAAAGAAGAGGAGCAATGG + Intergenic
1042321026 8:67475711-67475733 AAAAAAGAGAAGGGAAGGAAGGG - Intronic
1042380092 8:68103826-68103848 AGGAAAGGGAAGGGGAGAAAAGG - Intronic
1042572635 8:70183652-70183674 TTCCAAGAGAAGGGGTGGAAGGG - Intronic
1043715445 8:83479350-83479372 AACAAAGAGAAATGAAGCAAAGG + Intergenic
1044802054 8:95967096-95967118 ATCACAGAGAAAGGGAGTACAGG - Intergenic
1045246300 8:100444378-100444400 CTCAAAGAGAAGCGAAGCAAAGG - Intergenic
1047133104 8:122044469-122044491 AGCAAAGAGAAGGGAAGTACCGG - Intergenic
1047527501 8:125646097-125646119 ATCAAATAGGATGGGAGCATGGG + Intergenic
1048285817 8:133140845-133140867 ATTAAAGAGAAGGGGTGTTAAGG - Intergenic
1048571088 8:135657482-135657504 ATCAAGGAGAAGGGGACAGATGG - Intergenic
1048948196 8:139470298-139470320 ATCAAATAAATGTGGAGCAAGGG - Intergenic
1050271485 9:3950458-3950480 AGCAAAGGGAAGGGGAGGAGAGG - Intronic
1050601982 9:7262096-7262118 AGCGAAGAGAAGGGGAGGGAAGG - Intergenic
1050769436 9:9178298-9178320 AAGAAAGAGAAGGGGAGGAGAGG - Intronic
1051338593 9:16090606-16090628 ATGAAAGAGAAGGAAACCAATGG + Intergenic
1051776045 9:20635246-20635268 ATCCAAGAGAATTGGGGCAAAGG - Intergenic
1052474474 9:28941024-28941046 ATAAAAGAGAAAGGGAAGAAGGG + Intergenic
1053086940 9:35232979-35233001 TTCAAAGAGAAGGAGGCCAATGG + Intronic
1053578843 9:39381965-39381987 ATCAAAGAGACTAGGAGCACTGG - Intergenic
1053843358 9:42210040-42210062 ATCAAAGAGACTAGGAGCACTGG - Intergenic
1054100426 9:60940769-60940791 ATCAAAGAGACTAGGAGCACTGG - Intergenic
1054121823 9:61216394-61216416 ATCAAAGAGACTAGGAGCACTGG - Intergenic
1054585920 9:66966117-66966139 ATCAAAGAGACTAGGAGCACTGG + Intergenic
1055116285 9:72609051-72609073 AGAAAAGAGGAGGGGAGTAAGGG - Intronic
1055319284 9:75066392-75066414 ATAAAAGAAAAGGGGAGCTCTGG + Intronic
1056099932 9:83291587-83291609 GTCAAAGAGAGGGAGAGGAAGGG - Intronic
1056114552 9:83429401-83429423 ATCAAAGGGAGAGGGAGAAACGG - Intronic
1056817396 9:89811729-89811751 AGCAAAGAGAGGGGGAGGTAGGG + Intergenic
1057599470 9:96444829-96444851 ACCAGAGAGAAGGGAAGGAAGGG + Intergenic
1057842195 9:98495237-98495259 AGCCCAGAGAAGGGGAGCAAGGG - Intronic
1060444691 9:123677355-123677377 CTCTGAGTGAAGGGGAGCAATGG - Intronic
1203679372 Un_KI270756v1:50526-50548 ATCAAATGGAAGGGAAGGAATGG - Intergenic
1185529388 X:805594-805616 AACAAAGAAAAGGGAAGGAAGGG + Intergenic
1185630670 X:1514334-1514356 ATAAAAGGGAAGGGAAGGAAAGG - Intronic
1185963626 X:4575015-4575037 AACAAGGAAAAGGGGAGAAAAGG + Intergenic
1186081909 X:5942658-5942680 ATGAAAGAGAAGGAAAGGAAAGG + Intronic
1186449212 X:9658071-9658093 AGGAAAGAGAAGGTGTGCAAGGG - Intronic
1186580067 X:10808241-10808263 ATCACAGAGAAGGACAGCATAGG - Intronic
1186810930 X:13187861-13187883 ATCAATGAGAAGGGGAAGAAGGG - Intergenic
1186816862 X:13246586-13246608 ATGGAAGGGAAGGGGAGCAGAGG + Intergenic
1187117811 X:16371069-16371091 AGGAAAGAGAAAGGGAGAAAAGG + Intergenic
1187272857 X:17794178-17794200 ATCAAAGATGGGGGGGGCAATGG + Intergenic
1187383347 X:18825241-18825263 AGCAGAGAGAAGGGAAGTAAAGG + Intronic
1188504772 X:30870539-30870561 AACAAAGAGAAGGAGAGCTGAGG + Intronic
1188643264 X:32533453-32533475 ATTAAAGAGTAGGGAAGCATTGG - Intronic
1188786336 X:34351425-34351447 ATGAAAGAGAAGGGGAGAGAAGG + Intergenic
1188866401 X:35318316-35318338 GTCAAAGAGAAATGGAGAAATGG - Intergenic
1189467225 X:41286397-41286419 ATAAGAGAGAAGGGGAGAAAGGG + Intergenic
1189849564 X:45165172-45165194 AGGGAACAGAAGGGGAGCAAGGG + Intronic
1190983721 X:55481840-55481862 AGTAAAAGGAAGGGGAGCAAAGG + Intergenic
1191090797 X:56618523-56618545 AGGAAAGAAAAGGGGAACAATGG - Intergenic
1192266411 X:69541343-69541365 ATTAAAGAGAAGGCAGGCAAAGG - Intergenic
1196502246 X:116398664-116398686 ATGAAAGAAAAGGGGAGGAAGGG - Intergenic
1198273707 X:135080843-135080865 TTGTAAGAGAAGGGGAGGAAGGG + Intergenic
1198607789 X:138362030-138362052 ATCAAAGAGAGGGAGGCCAAAGG + Intergenic
1199051117 X:143238207-143238229 ATTGAAGAGAAGGAGAGCACTGG + Intergenic
1199506920 X:148573306-148573328 ATCCACTAGAGGGGGAGCAAGGG + Intronic
1199807557 X:151315426-151315448 AGCCAAAGGAAGGGGAGCAAAGG + Intergenic
1199927900 X:152488451-152488473 AGTAAAGAGAAGGTGAGAAATGG - Intergenic
1201894270 Y:18976897-18976919 AGCAAAGGGGAGGGGAGAAAGGG + Intergenic
1202104091 Y:21343730-21343752 ATCTCAGAGCAGAGGAGCAAAGG + Intergenic
1202612229 Y:56689346-56689368 ATCGAAGAGAATGGAAACAAAGG + Intergenic
1202612649 Y:56692905-56692927 ATCGAAGAGAATGGAAACAAAGG + Intergenic
1202615577 Y:56717863-56717885 ATCGAAGAGAATGGAAACAAAGG + Intergenic
1202619357 Y:56750058-56750080 ATCGAAGAGAATGGAAACAAAGG + Intergenic