ID: 948355617

View in Genome Browser
Species Human (GRCh38)
Location 2:237374764-237374786
Sequence GAGGGCCGACCCCCAACACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948355617_948355624 -3 Left 948355617 2:237374764-237374786 CCCGGTGTTGGGGGTCGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 314
Right 948355624 2:237374784-237374806 CTCCCAGCAGGGTCAGCTGGCGG 0: 1
1: 0
2: 3
3: 33
4: 329
948355617_948355621 -6 Left 948355617 2:237374764-237374786 CCCGGTGTTGGGGGTCGGCCCTC 0: 1
1: 0
2: 0
3: 17
4: 314
Right 948355621 2:237374781-237374803 GCCCTCCCAGCAGGGTCAGCTGG 0: 1
1: 0
2: 3
3: 26
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948355617 Original CRISPR GAGGGCCGACCCCCAACACC GGG (reversed) Exonic