ID: 948358526

View in Genome Browser
Species Human (GRCh38)
Location 2:237399952-237399974
Sequence GCTGATAATGAGATTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948358526 Original CRISPR GCTGATAATGAGATTGAGTC TGG (reversed) Intronic
902587704 1:17450992-17451014 GCTACTAAAGAGATTGAGGCAGG + Intergenic
904721234 1:32510428-32510450 GCAGATGCTGAGATAGAGTCAGG - Intronic
905081892 1:35330101-35330123 GCTGCTTGGGAGATTGAGTCAGG + Intronic
906966177 1:50458912-50458934 GGTAAAAATGAGATTTAGTCTGG + Intronic
907445057 1:54502099-54502121 GCTGGTAATGTGATGGAGGCTGG - Intergenic
909063336 1:70904249-70904271 GCTGATAAAGACATAGAGACTGG - Intronic
909238630 1:73183525-73183547 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238642 1:73183581-73183603 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238648 1:73183609-73183631 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238660 1:73183693-73183715 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238672 1:73183749-73183771 GCAGGTAATGGGAATGAGTCAGG - Intergenic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
912392240 1:109311493-109311515 GCCAATAATGAGAATGAGCCAGG + Exonic
912634201 1:111276366-111276388 TCTAATAAAGAGATAGAGTCTGG - Intergenic
912968273 1:114256445-114256467 GATGATAATGCCATTGAGTCAGG + Intergenic
913577886 1:120195795-120195817 GCTGCTCAGGAGATTGAGGCAGG + Intergenic
913630283 1:120702534-120702556 GCTGCTCAGGAGATTGAGGCAGG - Intergenic
914559801 1:148807218-148807240 GCTGCTCAGGAGATTGAGGCAGG + Intergenic
914613032 1:149323005-149323027 GCTGCTCAGGAGATTGAGGCAGG - Intergenic
919745135 1:201004142-201004164 ACTGATAAGGAAACTGAGTCTGG + Intronic
922970245 1:229729946-229729968 GCTGACTATGAGATTAGGTCAGG + Intergenic
1063242269 10:4183223-4183245 GCTTATAATGATATTGACTGTGG + Intergenic
1064756668 10:18577772-18577794 GCAGGTAATCAGAATGAGTCAGG - Intronic
1064773740 10:18752614-18752636 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1064833236 10:19495086-19495108 GCTGCTAATGAGGCTGAGGCGGG - Intronic
1065810590 10:29439183-29439205 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1065810594 10:29439211-29439233 GCAGGTAATCGGATTGAGTCAGG + Intergenic
1068323804 10:55456806-55456828 GATGATAATGCTGTTGAGTCTGG + Intronic
1068434746 10:56975654-56975676 GCTGATAAAGTGATTCACTCAGG + Intergenic
1070925570 10:80218992-80219014 GCTGATAATCAGCTAGACTCTGG - Intergenic
1071282740 10:84117371-84117393 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1071282900 10:84118848-84118870 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1071283897 10:84126535-84126557 GCAGGTAATCAGAATGAGTCGGG + Intergenic
1071283906 10:84126591-84126613 GCAGGTAATGGGAATGAGTCAGG + Intergenic
1072441676 10:95462441-95462463 GCAAATAATGAGATTGTGTTAGG - Intronic
1072922566 10:99588855-99588877 GCTGACATTGAGATTGTTTCTGG - Intergenic
1074989298 10:118688551-118688573 GCTGCTGAAGAGATTAAGTCCGG + Intronic
1076295570 10:129381252-129381274 GCTGACAATGAAAATGAGTGTGG + Intergenic
1078971899 11:16423630-16423652 GCTGAAAAGGAGATTGACTTAGG + Intronic
1081419493 11:42856831-42856853 ACTGATAATGATAGTGGGTCAGG + Intergenic
1081769439 11:45639302-45639324 GCTACTCATGAGATTGAGACAGG - Intergenic
1085357409 11:75851294-75851316 CCTGATTATGAAATTGAGACTGG + Intronic
1085499527 11:77006998-77007020 GCTGCTCAGGAGATTGAGGCAGG + Intronic
1085543989 11:77300119-77300141 GCTGGTAATCAGAATGAGTCAGG - Intronic
1086196168 11:84142517-84142539 GCTGATAATAACATTGCCTCTGG + Intronic
1086487418 11:87322453-87322475 GCTGATAATGAGAGTAGTTCAGG + Intronic
1087640533 11:100750478-100750500 GCAGATAGTCAGAATGAGTCAGG + Intronic
1089828683 11:121304692-121304714 GCTGTAGATGAGATTGTGTCTGG + Intronic
1091937875 12:4447608-4447630 GGTGATGATGAGATTGGGTATGG - Intergenic
1094018664 12:25891224-25891246 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1094583799 12:31758547-31758569 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1095817797 12:46443611-46443633 GCTGACAAGGAGATTGAGAGAGG + Intergenic
1096199508 12:49671608-49671630 CCTGATAATGTGTGTGAGTCTGG + Intronic
1097644680 12:62222252-62222274 GCTTATACTGAGAATGAGCCAGG - Intronic
1097715962 12:62966558-62966580 GCCGGTAATGGGAATGAGTCAGG - Intergenic
1099875290 12:88397108-88397130 GTTGTAAATGGGATTGAGTCTGG - Intergenic
1100183877 12:92115944-92115966 GCTGAAAATGAGATGGAGTTAGG - Intronic
1100573427 12:95864795-95864817 GCTGCTCAGGAGATTGAGGCAGG + Intronic
1101440109 12:104697485-104697507 GCTGGTGGTGAGATTCAGTCTGG - Intronic
1101565221 12:105898481-105898503 GCAGGTAATTAGAATGAGTCAGG + Intergenic
1104196806 12:126548186-126548208 AGAGATAATGAGCTTGAGTCTGG - Intergenic
1105458764 13:20565252-20565274 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1105569046 13:21582641-21582663 GCAGGTAATTAGAATGAGTCAGG - Intronic
1107913387 13:45125776-45125798 GCTGATTTTGAGATGGAGACAGG + Intronic
1109339424 13:61036468-61036490 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1112297250 13:98198864-98198886 GTTGAGATTGAGATGGAGTCTGG - Intronic
1115993651 14:39174268-39174290 ACTGATAAGGAAATTGAGACTGG - Intergenic
1117480251 14:56136439-56136461 GTTGAAAATGAGATTAAATCAGG + Intronic
1117757474 14:58990674-58990696 ACTGATAATAAGATGGAGTTTGG + Intergenic
1118714112 14:68547248-68547270 GCTGATCATGACCTTGTGTCGGG + Intronic
1119692016 14:76680834-76680856 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1120473896 14:84962445-84962467 GATGAAAATGAGATTGAGACTGG - Intergenic
1121133949 14:91477758-91477780 GCTGCTAAGGAGACTGAGACAGG - Intronic
1121668056 14:95687250-95687272 GGTGATAATGATAATGACTCAGG + Intronic
1125158201 15:36613718-36613740 GCTGCTGATGAGAGTGAGACAGG + Intronic
1125453231 15:39830921-39830943 GCTTATACTGACATTGACTCTGG - Intronic
1127108945 15:55646951-55646973 GCTGGTGATGAGAATGAATCAGG - Intronic
1127123759 15:55792707-55792729 GCTGGAAATGAAATTGAGCCTGG + Intergenic
1128602336 15:69007802-69007824 GCAGATAATCAGAATGAGTTAGG - Intronic
1129529703 15:76254371-76254393 GAACATAAGGAGATTGAGTCTGG + Intronic
1129988233 15:79937391-79937413 GCTGCTGAGGAGATTGAGGCAGG + Intergenic
1131081714 15:89542123-89542145 GCTGAAAATGCAACTGAGTCAGG + Intergenic
1132107379 15:99072947-99072969 GCTAATCATGAGACCGAGTCGGG - Intergenic
1135148191 16:19981967-19981989 GCTCATAAAGAGAGTGAATCAGG - Intergenic
1138045019 16:53712861-53712883 GCTGCTAATGAGATTTACTGTGG + Intronic
1138296587 16:55891015-55891037 GCAGATAATCGGAATGAGTCAGG - Intronic
1141640978 16:85341299-85341321 GCTGATTAGGAGACTGAGGCAGG - Intergenic
1141799308 16:86296263-86296285 CCTGATAAGCAGAGTGAGTCTGG - Intergenic
1143880439 17:10025732-10025754 GCTGCTCTGGAGATTGAGTCAGG - Intronic
1145240653 17:21239414-21239436 GATGATACTGAGGCTGAGTCGGG - Exonic
1146542784 17:33711996-33712018 GATGATGATTGGATTGAGTCAGG - Intronic
1149275621 17:55031725-55031747 GCTGTCTATGAGATTGAGTATGG - Intronic
1152261813 17:79271467-79271489 GCGGCTAATGAGCTTGAGTCCGG - Intronic
1153656393 18:7286580-7286602 GCTGATGGTGTGATTCAGTCAGG + Intergenic
1153826906 18:8883175-8883197 GTAGATAATCAGAATGAGTCAGG + Intergenic
1156339931 18:36201548-36201570 GCTGCTCAAGAGATTGAGGCAGG + Intronic
1157600593 18:48890798-48890820 GGTGAGAATGTGGTTGAGTCAGG + Intergenic
1157632696 18:49114730-49114752 GCTGCTCAGGAGACTGAGTCAGG - Intronic
1158317548 18:56228285-56228307 GCTGATAATAAGATTGGGGTAGG + Intergenic
1158358611 18:56647883-56647905 GCTGATGCTGAGATGGAGTGAGG + Intronic
1159556319 18:69949080-69949102 ACCGAAAATGAGACTGAGTCTGG + Intronic
1162278100 19:9674287-9674309 GCAGGTAATCAGAATGAGTCAGG + Intronic
1163927490 19:20360068-20360090 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1163929527 19:20375727-20375749 GCAGGTAATGGGAATGAGTCAGG - Intergenic
1164655396 19:29917489-29917511 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1167850645 19:52198719-52198741 TATGATATTGAAATTGAGTCAGG + Intronic
927838399 2:26420372-26420394 GCAGATAATGACAGTGAGGCAGG - Intronic
928439880 2:31283585-31283607 GCAGGTAATCAGAATGAGTCAGG - Intergenic
928439892 2:31283667-31283689 GCAGGTAATCAGAATGAGTCAGG - Intergenic
928637358 2:33261502-33261524 ACTGAAAATGAGAGTGAGTCCGG + Intronic
928973588 2:37059573-37059595 GCTACTCAGGAGATTGAGTCAGG - Intronic
931425790 2:62169848-62169870 GCAGATGATCAGAGTGAGTCAGG - Intergenic
935047643 2:99496856-99496878 GCAGGTAATCAGAATGAGTCGGG - Intergenic
935048602 2:99504186-99504208 GCAGGTAATCAGAATGAGTCAGG - Intergenic
938976170 2:136480675-136480697 GCTGATGTTGAGAATGAGACAGG - Intergenic
939114181 2:138041586-138041608 GCAGATAATTAGATGGTGTCAGG + Intergenic
939193553 2:138944730-138944752 GTAAATAATGAGATTGATTCTGG - Intergenic
939913248 2:148008562-148008584 GCAGATGATCAGAATGAGTCAGG - Intronic
940802226 2:158145409-158145431 GCAGGTAATCAGAATGAGTCAGG - Intergenic
943979666 2:194531998-194532020 GCTGCTCAGGAGATTGAGGCAGG - Intergenic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
948358526 2:237399952-237399974 GCTGATAATGAGATTGAGTCTGG - Intronic
948878424 2:240842558-240842580 GCAGGTAATCAGAATGAGTCGGG + Intergenic
948878456 2:240842721-240842743 GCAGGTAATCAGAATGAGTCGGG + Intergenic
948878489 2:240842910-240842932 GCAGGTAATCAGAATGAGTCAGG + Intergenic
948878542 2:240843181-240843203 GCAGGTAATCAGAATGAGTCGGG + Intergenic
1171256446 20:23692201-23692223 GCTAATTAGGAGAGTGAGTCAGG + Intergenic
1171263802 20:23754125-23754147 GCTTATTAGGAGAGTGAGTCAGG + Intergenic
1171272970 20:23830795-23830817 GCTAATTAGGAGAGTGAGTCAGG + Intergenic
1173133655 20:40418882-40418904 GCTGATGATGTGGTTCAGTCTGG - Intergenic
1174008870 20:47432761-47432783 GCTACTCAGGAGATTGAGTCAGG + Intergenic
1175191387 20:57214346-57214368 GCTGATAAAGGGTTTGAGGCAGG - Intronic
1177175019 21:17693876-17693898 GCTGCTGATGATGTTGAGTCAGG + Intergenic
1178408254 21:32343152-32343174 ACTTATAATGAGATAGACTCTGG + Intronic
1178710985 21:34916600-34916622 GATGATGACTAGATTGAGTCTGG + Intronic
1178836665 21:36104390-36104412 GCAGGTAATCAGAATGAGTCCGG - Intergenic
949610769 3:5701180-5701202 GCAGGTAATCAGAATGAGTCAGG + Intergenic
950642687 3:14358716-14358738 GCTGATAATTACATTAATTCTGG + Intergenic
950846987 3:16024063-16024085 GCAGGTAATCAGAATGAGTCAGG + Intergenic
950855597 3:16101717-16101739 GCAGTTGATGAGAATGAGTCTGG + Intergenic
951526694 3:23659904-23659926 GAAGAGAATGAGATTAAGTCAGG - Intergenic
954481012 3:50801406-50801428 GCAGATAATTGGAATGAGTCAGG + Intronic
954604317 3:51897084-51897106 GCAGGTAATGGGAATGAGTCAGG - Intronic
955623265 3:60889100-60889122 GCAGGTAATCAGAATGAGTCAGG - Intronic
955765489 3:62340141-62340163 GCTTATAAAGATATTGACTCAGG - Intergenic
957497870 3:81013727-81013749 GTAGATGATGAGATTAAGTCAGG - Intergenic
957742658 3:84292062-84292084 GCTGATAATGAAATTGAGGTTGG - Intergenic
958772091 3:98437277-98437299 GCTGATAATAAGGGTGAGGCTGG - Intergenic
958796692 3:98713576-98713598 GCAGGTAATCAGAATGAGTCAGG + Intergenic
960179100 3:114553531-114553553 GCTAATAATAAGACTGAGTTAGG - Intronic
960616973 3:119605136-119605158 GCTGATAAAATGATGGAGTCAGG + Intronic
960720090 3:120617028-120617050 GCAGGTAATCAGAATGAGTCAGG + Intergenic
961957414 3:130818312-130818334 GCAGGTAATCAGAATGAGTCAGG + Intergenic
963030846 3:140974121-140974143 GTTCATAATGAGATTAAATCTGG + Intronic
963109828 3:141678863-141678885 GCTGCTCAGGAGATTGAGGCGGG + Intergenic
964902966 3:161682003-161682025 GCAGGTAATCAGAATGAGTCAGG + Intergenic
965316173 3:167193504-167193526 GCTTCTATTGAGATTGAGACAGG + Intergenic
966137724 3:176719072-176719094 ACTGATGATAAGATAGAGTCTGG - Intergenic
966306512 3:178541907-178541929 GCAGGTAATCAGAATGAGTCAGG - Intronic
966998525 3:185309211-185309233 GCTCATAAAAAGATTGAGGCTGG + Intronic
968111913 3:196055434-196055456 GCAGATAATGAGATAGAATTGGG - Intronic
970078672 4:12254609-12254631 GCTGCTCAGGAGATAGAGTCTGG + Intergenic
970092458 4:12426038-12426060 GCAGGTAATCAGAATGAGTCAGG + Intergenic
970317241 4:14841171-14841193 CCTGATAAAAAGAGTGAGTCTGG - Intergenic
970331223 4:14986392-14986414 GCAGATAAGGAGATTGAAACTGG - Intergenic
972614908 4:40688697-40688719 GTTGATTCTGAGAATGAGTCAGG - Intergenic
973307863 4:48673497-48673519 GCTACTTATGAGATTGAGGCTGG - Intronic
973612844 4:52653391-52653413 GCTGCTCAGGAGATTGAGGCAGG + Intronic
974074575 4:57157048-57157070 GCTGATGCTGAGATGGAGTTTGG + Intergenic
974409851 4:61525963-61525985 GCTGATAAAGAGATTGATTGGGG + Intronic
974486092 4:62508084-62508106 GCTGATAATGATAGTGAGGTGGG + Intergenic
975911949 4:79277606-79277628 GCAGGTAATCAGAATGAGTCAGG - Intronic
978180287 4:105786398-105786420 GCTACTAAGGAGACTGAGTCAGG + Intronic
978314409 4:107419617-107419639 GCAGGTAATCAGAATGAGTCAGG - Intergenic
978314423 4:107419729-107419751 GCAGGTAATCAGAATGAGTCAGG - Intergenic
979408962 4:120350857-120350879 GCTGTTAATGAGAGTGAGTTTGG + Intergenic
980438570 4:132812912-132812934 GCAGGTAATCAGAATGAGTCAGG + Intergenic
980560979 4:134475390-134475412 GCTGTCTATGAGGTTGAGTCCGG + Intergenic
981048254 4:140285851-140285873 GCAGATAAGGAAACTGAGTCTGG - Intronic
981864442 4:149398816-149398838 GCTGCTCAGGAGAATGAGTCAGG - Intergenic
982430020 4:155312232-155312254 GCAGGTAATCAGAATGAGTCAGG + Intergenic
984672152 4:182503039-182503061 TCTGCTAATGAGATTGAGAAAGG + Intronic
986587314 5:9332030-9332052 GCTGATACTCACATTGGGTCAGG + Intronic
989388635 5:40877831-40877853 GCAGGTAATCAGAGTGAGTCAGG + Intergenic
990240289 5:53810292-53810314 ACAGATAAAGAAATTGAGTCTGG - Intergenic
994607544 5:101988416-101988438 GCTCATTATGAGATAGAGTTGGG + Intergenic
994870616 5:105345540-105345562 GCTGATAAAGACATAGAGACTGG + Intergenic
995319981 5:110823610-110823632 GCTGACAATGAGAGTGAGGAGGG - Intergenic
995731654 5:115249630-115249652 GCAGGTAATCAGAATGAGTCAGG + Intronic
996072530 5:119149784-119149806 GATGATACTGAGGTAGAGTCGGG - Exonic
996587276 5:125103681-125103703 GCTCTTAATTAGATTGAGTCAGG + Intergenic
998552247 5:143088893-143088915 GCAGATAATCGGAATGAGTCAGG + Intronic
998552254 5:143088921-143088943 GCAGGTAATGGGAATGAGTCAGG + Intronic
998552983 5:143094811-143094833 GCAGGTAATCAGAATGAGTCAGG + Intronic
998552990 5:143094839-143094861 GCAGGTAATGGGAATGAGTCGGG + Intronic
1001403312 5:171459273-171459295 GCTGATAATCACAGTGATTCAGG + Intergenic
1003287511 6:4747193-4747215 GCTACTCATGAGATTGAGGCAGG + Intronic
1003824472 6:9937651-9937673 ACTGCTAATGAGAGTGAGACTGG + Intronic
1004317251 6:14600449-14600471 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1004895515 6:20144075-20144097 ACTGCTAATGGGATTGAGGCTGG - Intronic
1005853873 6:29845553-29845575 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1007648744 6:43403176-43403198 GCTAATAAGTAGTTTGAGTCAGG - Intergenic
1008580122 6:52899049-52899071 GCAGGTAATCAGAATGAGTCAGG + Intronic
1010786047 6:80003115-80003137 ACTCATAAGCAGATTGAGTCAGG - Intergenic
1011365884 6:86582097-86582119 GCCGATAATCGGAATGAGTCAGG + Intergenic
1011569935 6:88724798-88724820 GCAGGTAATGGGAATGAGTCAGG - Intronic
1011570592 6:88730258-88730280 GCAGGTAATGGGAATGAGTCAGG - Intronic
1014369497 6:120586804-120586826 TCTGATGGTGAGATTGAGTTCGG - Intergenic
1015457355 6:133441786-133441808 GCAGGTAATCAGAATGAGTCAGG + Intronic
1015675043 6:135736519-135736541 GCTGCTCATGAGGCTGAGTCAGG + Intergenic
1018191818 6:161315502-161315524 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1018191853 6:161315730-161315752 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1018351713 6:162966586-162966608 GCTGCTCATGAGACTGAGGCAGG - Intronic
1020459005 7:8406837-8406859 GCTGCTGATAAGATTCAGTCAGG - Intergenic
1021817014 7:24456960-24456982 TCTGAAAGTGAGATTTAGTCAGG - Intergenic
1024555434 7:50599510-50599532 GCAGATAATGGGATTGATTCAGG - Intronic
1025064418 7:55841009-55841031 GCTGCTCATGAGACTGAGGCAGG - Intronic
1026799288 7:73388733-73388755 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1028601057 7:92600966-92600988 GCTGCTTAGGAGATTGAGGCAGG - Intergenic
1030167460 7:106569618-106569640 GCAGGTAATCAGAATGAGTCAGG - Intergenic
1031228216 7:119069370-119069392 GCCATTAATTAGATTGAGTCTGG + Intergenic
1031610908 7:123826214-123826236 TCTGATAATGAGATAGAGATAGG + Intergenic
1032348412 7:131138035-131138057 GCTACTCATGAGATTGAGGCAGG - Intronic
1033096820 7:138439459-138439481 GCAGATAATCAGAATGAGTCAGG + Intergenic
1035010087 7:155707766-155707788 GCTACTAAAGAGATTGAGGCAGG - Intronic
1035678272 8:1470048-1470070 GCTGCTCATGAGGTTGAGGCAGG + Intergenic
1036971584 8:13361364-13361386 GCTGCTCAGGAGGTTGAGTCAGG - Intronic
1037509504 8:19567371-19567393 TATGTTAATGAGAGTGAGTCAGG + Intronic
1038586721 8:28796196-28796218 GCTACTCAGGAGATTGAGTCAGG + Intronic
1042274327 8:66987257-66987279 GCTAAAAATGAGATGGAGACAGG - Intronic
1043862130 8:85331566-85331588 GCTAATCAGGAGATTGAGCCAGG - Intronic
1046230376 8:111348024-111348046 GCTATTCAAGAGATTGAGTCAGG - Intergenic
1047670409 8:127140156-127140178 CCTGATAATCATATGGAGTCAGG + Intergenic
1047787999 8:128172971-128172993 GATGAAAATGAGATTGTGTAAGG + Intergenic
1048363078 8:133714964-133714986 GGGGAAAATGAGACTGAGTCTGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1051540694 9:18213491-18213513 GCTGAAAAGGTGATTGAGCCTGG + Intergenic
1054901515 9:70373854-70373876 AATGATAATGAGATAGAGTAAGG - Intergenic
1056210684 9:84362193-84362215 GCTGATAATGAGGCAGAGACTGG + Intergenic
1056642249 9:88381536-88381558 GTAGATAATCAGAATGAGTCAGG + Intergenic
1059024793 9:110614857-110614879 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1059369546 9:113816192-113816214 GCTTACAATTAGATTAAGTCAGG - Intergenic
1060386728 9:123237123-123237145 GTTGTTATTGAGATGGAGTCTGG - Intronic
1185662727 X:1740025-1740047 GCTAATCAGGAGATTGAGGCAGG - Intergenic
1185725135 X:2413878-2413900 GGTTATAATGAGATTTAGTTGGG - Intronic
1186369210 X:8929714-8929736 GCTGCTCAGGAGACTGAGTCAGG - Intergenic
1188146712 X:26622756-26622778 GCTGGTAGTTAGATTGAGACAGG - Intergenic
1189034791 X:37484458-37484480 GCAGGTAATCAGAATGAGTCAGG - Intronic
1189056671 X:37706533-37706555 GCAGATAAAGAGATTGAGGTTGG + Intronic
1190010489 X:46780546-46780568 GCTGACACTGAGATGGAGTTCGG - Intergenic
1190571076 X:51782230-51782252 GCAGATAATGAGACAGAGTTAGG - Intergenic
1192232238 X:69273297-69273319 GCTGATGAAGAGATGGAGTCTGG - Intergenic
1192327035 X:70141785-70141807 GCTGATAAAGAAATTGAGGCTGG - Intronic
1193146001 X:78076259-78076281 GCAGGTAATCAGAGTGAGTCAGG + Intronic
1196173369 X:112614327-112614349 GCTGGGAATGAGGTTGAGTAGGG + Intergenic
1196516035 X:116613079-116613101 GGTGATAATGACATAGAGACAGG + Intergenic
1197584090 X:128323134-128323156 GCTGATAATGACATTGATGATGG - Intergenic
1199044954 X:143158973-143158995 TCTGATAATGACAATGAGTTTGG - Intergenic
1200763023 Y:7057116-7057138 GCAGGTAATCAGAATGAGTCAGG + Intronic
1200763028 Y:7057144-7057166 GCAGGTAATTGGATTGAGTCAGG + Intronic
1200769130 Y:7107398-7107420 GCAGGTAATCAGAATGAGTCAGG + Intergenic
1200769475 Y:7110289-7110311 GCAGGTAATTGGATTGAGTCAGG - Intergenic