ID: 948358672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:237401926-237401948 |
| Sequence | CTTAGGAAGGCTAAGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 69958 | |||
| Summary | {0: 1, 1: 9, 2: 289, 3: 6579, 4: 63080} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948358672_948358678 | -8 | Left | 948358672 | 2:237401926-237401948 | CCTTCCACCTTAGCCTTCCTAAG | 0: 1 1: 9 2: 289 3: 6579 4: 63080 |
||
| Right | 948358678 | 2:237401941-237401963 | TTCCTAAGTGCTGGGATTACAGG | 0: 64 1: 11514 2: 308852 3: 265685 4: 156970 |
||||
| 948358672_948358680 | 11 | Left | 948358672 | 2:237401926-237401948 | CCTTCCACCTTAGCCTTCCTAAG | 0: 1 1: 9 2: 289 3: 6579 4: 63080 |
||
| Right | 948358680 | 2:237401960-237401982 | CAGGCGTGAGCCACTGTGCACGG | 0: 82 1: 8196 2: 44544 3: 106541 4: 136127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948358672 | Original CRISPR | CTTAGGAAGGCTAAGGTGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||