ID: 948358672

View in Genome Browser
Species Human (GRCh38)
Location 2:237401926-237401948
Sequence CTTAGGAAGGCTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69958
Summary {0: 1, 1: 9, 2: 289, 3: 6579, 4: 63080}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948358672_948358678 -8 Left 948358672 2:237401926-237401948 CCTTCCACCTTAGCCTTCCTAAG 0: 1
1: 9
2: 289
3: 6579
4: 63080
Right 948358678 2:237401941-237401963 TTCCTAAGTGCTGGGATTACAGG 0: 64
1: 11514
2: 308852
3: 265685
4: 156970
948358672_948358680 11 Left 948358672 2:237401926-237401948 CCTTCCACCTTAGCCTTCCTAAG 0: 1
1: 9
2: 289
3: 6579
4: 63080
Right 948358680 2:237401960-237401982 CAGGCGTGAGCCACTGTGCACGG 0: 82
1: 8196
2: 44544
3: 106541
4: 136127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948358672 Original CRISPR CTTAGGAAGGCTAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr