ID: 948359761

View in Genome Browser
Species Human (GRCh38)
Location 2:237411988-237412010
Sequence CTTGGGAAGGAATTCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359761_948359770 30 Left 948359761 2:237411988-237412010 CCAACATGGAATTCCTTCCCAAG 0: 1
1: 0
2: 3
3: 21
4: 174
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359761_948359767 8 Left 948359761 2:237411988-237412010 CCAACATGGAATTCCTTCCCAAG 0: 1
1: 0
2: 3
3: 21
4: 174
Right 948359767 2:237412019-237412041 TCCACTCAGTGTCTGCTTCCTGG 0: 1
1: 0
2: 8
3: 67
4: 1020

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359761 Original CRISPR CTTGGGAAGGAATTCCATGT TGG (reversed) Intronic
900294482 1:1942084-1942106 CTTGGGCAGGAGCTCCAGGTGGG + Exonic
903895730 1:26602620-26602642 CTCGGGAAAGAAATACATGTGGG - Intergenic
906814265 1:48862053-48862075 GGTGGGAAGGAGTTCCTTGTTGG - Intronic
907900677 1:58738610-58738632 CTTTAGAAGGAATTCAAGGTGGG - Intergenic
910023158 1:82617599-82617621 CCTAGGAAGGAATTTCATGATGG + Intergenic
910041897 1:82862585-82862607 TTTGGGCAGGAATACCATGTAGG - Intergenic
911113117 1:94213093-94213115 CTTGGGAAGGAAGGCAATATAGG - Intronic
911499547 1:98668061-98668083 CTTGGGGAGGAAGTCTAGGTAGG + Intronic
914428107 1:147597597-147597619 CTTGAGAAAGAATTCTATTTTGG - Intronic
914886257 1:151586826-151586848 GTTTGGAAGGAAGTCCATTTTGG - Intergenic
915970201 1:160349521-160349543 ATAGGAAAGGAATTCCATGAAGG - Intronic
917049053 1:170897750-170897772 CTGGGGAAAGAGATCCATGTGGG - Intergenic
917701359 1:177584918-177584940 CTTGGTAGGTAATTCCATCTAGG - Intergenic
918203516 1:182289094-182289116 CTTTGGAAGAAATTCCAAGTAGG + Intergenic
919455592 1:197816462-197816484 CTTGGAAAGCATTTACATGTGGG - Intergenic
920793271 1:209113129-209113151 CTTGGGAAGGAATAACATTCTGG - Intergenic
923352489 1:233122861-233122883 TTTGGGGAGGAAGACCATGTAGG - Intronic
924175257 1:241385128-241385150 CTTGGGAAGTAATTGAATATGGG - Intergenic
1064669031 10:17689367-17689389 CTTGGGAAGAAAGCACATGTAGG - Intronic
1065172406 10:23044799-23044821 GATGGAAAGGAATTCTATGTTGG + Intergenic
1066988113 10:42486392-42486414 CATGGGAAGGATTTCTATGGTGG - Intergenic
1067563607 10:47321361-47321383 CTGGGGAAGGTATTCTATGCTGG - Intergenic
1071470801 10:85982983-85983005 CTTGAGAGGAAATGCCATGTAGG - Intronic
1071488373 10:86118784-86118806 TTTGGGAAGGAAGACCATGGAGG - Intronic
1075907446 10:126093848-126093870 CTTGGGAAGGAATTACTTTTTGG + Intronic
1078406690 11:11075995-11076017 CTTGGAAGGGAATTCCAGGCAGG + Intergenic
1079355413 11:19726460-19726482 CTGGGGAAGACATTCCATGCAGG - Intronic
1081460479 11:43268271-43268293 CTTGGGAAGGATTTCACTGGTGG + Intergenic
1081692333 11:45086870-45086892 GCTGAGAAGGAATTCCAGGTGGG - Intergenic
1081910650 11:46697748-46697770 CTTGGGAAGGGATTATATTTTGG - Intronic
1084051467 11:66602907-66602929 GGTGGAAAAGAATTCCATGTGGG + Intronic
1087046002 11:93844474-93844496 CTTGGGAAGGCTTTGCATCTTGG - Intronic
1087438937 11:98158496-98158518 CTTGAGAAGGAATGCGAGGTAGG - Intergenic
1090211344 11:124922954-124922976 CTTTGGAAGGAATCACATCTAGG + Intronic
1091384851 12:86964-86986 TTGGGGAAGGAATTTCATGGAGG - Intronic
1091622552 12:2100345-2100367 CTGAGGAAGGAATTCCTTGAAGG + Intronic
1091805427 12:3352609-3352631 CTTGGTAAAGCATTGCATGTTGG - Intergenic
1092067875 12:5607112-5607134 TTGGGGAAAGAATTCCATGTAGG + Intronic
1093411684 12:18875902-18875924 CTTGGGAGGCAAGTCCTTGTTGG - Intergenic
1096170725 12:49467431-49467453 CTTGGGGAGTAATTCAAGGTTGG + Intronic
1097683474 12:62670739-62670761 CTTGAGAAGGATTTTCATGTTGG - Intronic
1097823789 12:64154358-64154380 CTTGGGAAGGAATGGCATGAGGG + Exonic
1098034648 12:66289507-66289529 CTTGGGTTGGAACCCCATGTGGG + Intergenic
1101827307 12:108230715-108230737 CTTGGGAAGGAATTACCTAGAGG + Intronic
1102775929 12:115519132-115519154 GTGGGGAAAGAAATCCATGTTGG + Intergenic
1103580284 12:121909690-121909712 CTTCGAAGGGAATTCCTTGTCGG + Intronic
1103757936 12:123224587-123224609 ATGGGGAAGGAACTCCATGTTGG + Intronic
1104240000 12:126979233-126979255 CTTGGGAAAGAATTCTTGGTCGG + Intergenic
1105028709 12:132868068-132868090 ATTGGGAAGAAATTCCATCTGGG - Intronic
1108426843 13:50310911-50310933 CTTTGGAAGGAGTCCCATGCAGG + Intronic
1109867043 13:68278337-68278359 CTAGGCAATGATTTCCATGTAGG + Intergenic
1112386004 13:98940309-98940331 CTGAAGAAGGAATTCCATTTAGG + Intronic
1114634103 14:24177806-24177828 CTTGGGGAGGCAGTCCTTGTGGG - Intronic
1114946559 14:27688983-27689005 CTTGTGAAGGTGTTCCATGCAGG - Intergenic
1116378277 14:44231707-44231729 CTTGGGAAGGAATTGGATTATGG - Intergenic
1119009362 14:70968689-70968711 CCTGGGAAGGAAATTCATGTTGG + Intronic
1121568704 14:94930361-94930383 CTTGGAAAGGGATTCCAGGCAGG + Intergenic
1122858168 14:104569996-104570018 CTCGGGAATGACCTCCATGTGGG + Intronic
1202897070 14_GL000194v1_random:16498-16520 CTTGGGATGGATGTCCATCTGGG - Intergenic
1123894425 15:24814319-24814341 CATGGGAAGGAATTGAATGTAGG - Intergenic
1123922347 15:25079216-25079238 CTTAGGAAGGGATTCCGTTTGGG + Intergenic
1128141465 15:65303784-65303806 CTTAGAAAGGAATTCCCTGTAGG + Intergenic
1130391327 15:83458303-83458325 ATTGGGAAGGAATTCCCATTGGG - Intronic
1130665407 15:85865187-85865209 CCTGGGAAGGAATGCCCTGGAGG - Intergenic
1132993124 16:2807645-2807667 CTTGGGTAGGAAATCCACATGGG + Intergenic
1134848134 16:17458506-17458528 CTTGGAAAGGAATTCCCCATTGG - Intronic
1134856128 16:17520975-17520997 TTTGGGAAGTAGTTCCATGGAGG + Intergenic
1135149909 16:19996327-19996349 CTTGGGAATCAATTGCAAGTAGG - Intergenic
1135691002 16:24537774-24537796 CTTCGGAGTGAATTCCATGACGG + Intronic
1138950835 16:61910764-61910786 CTTGGAAAGTAATTCCAGATTGG - Intronic
1138982816 16:62291387-62291409 CTGGGTAAAGAATTTCATGTAGG - Intergenic
1139369996 16:66461109-66461131 CTTGGGAAGAAAGTCCAGGAAGG + Intronic
1139927438 16:70497732-70497754 CTTGGGAAGGAAGTCCTAGCTGG + Intronic
1142674844 17:1507344-1507366 CTAGAGATGGAATTCCAAGTTGG - Intronic
1146083594 17:29806242-29806264 CTCCGGAATGAATGCCATGTAGG + Intronic
1147732980 17:42615410-42615432 CCTGGAAAGGAATTTCAGGTGGG - Intergenic
1150344484 17:64393814-64393836 GTGGGGAAGGCATTCCAAGTAGG - Intronic
1150957160 17:69871814-69871836 TCTAGGAAGAAATTCCATGTTGG + Intergenic
1151579686 17:74971188-74971210 CTGGGGAAGAAACTCCTTGTTGG - Intronic
1151788897 17:76291291-76291313 TCTGGGCAGGAATTCCATGTCGG + Exonic
1153011293 18:542007-542029 TTAGAGAAGGAACTCCATGTGGG + Intergenic
1153927506 18:9847037-9847059 CTGGGGCTGGAATTTCATGTGGG + Intronic
1156043535 18:32851942-32851964 CTTGGGAATGAATTCACTGAAGG - Intergenic
1156668419 18:39437083-39437105 CTTGGGAGGGAAAGCCTTGTTGG - Intergenic
1157402270 18:47398564-47398586 CAAGGGAAGGCATTCCAGGTAGG - Intergenic
1157560131 18:48639862-48639884 CCTGGGAAGGAAACCCAGGTGGG - Intronic
1158012407 18:52744050-52744072 CTTAAGAAGGAATTTCATGGAGG + Intronic
1158428939 18:57366227-57366249 CAAGGGAAGCATTTCCATGTTGG + Exonic
1163586854 19:18168971-18168993 CTTGGGAAGGAGTCCCTGGTGGG + Intronic
1163696256 19:18765052-18765074 CTTTGGATGGAATTCCAGGAAGG - Intronic
1164967625 19:32499147-32499169 CTTGGGAGGGACTTACACGTGGG - Intergenic
925612706 2:5716038-5716060 CCTGTGGAGGAATTCCATGGTGG - Intergenic
926379306 2:12268926-12268948 CTAGGTATAGAATTCCATGTTGG - Intergenic
926655879 2:15405074-15405096 CTTGAGAAGACATTCCAGGTAGG - Intronic
930008233 2:46915200-46915222 CTTTGCAAGGGATTCGATGTGGG + Intronic
931036508 2:58250341-58250363 CTTGGGAAGGAATTGCCTATGGG - Intergenic
931817834 2:65921984-65922006 CCTGGGAATGAAGTCCACGTAGG + Intergenic
932185148 2:69688287-69688309 TTTGGGAAGGAATGCTTTGTTGG + Intronic
932395852 2:71447099-71447121 CTTGGTAAGGATTTCCATGCAGG + Intergenic
932995607 2:76848018-76848040 GTTTAGAAGAAATTCCATGTTGG + Intronic
937169368 2:119850321-119850343 ATAGGGCAGAAATTCCATGTAGG - Intronic
937242983 2:120474437-120474459 CTGGGGAAGGAAATCCAAATGGG - Intergenic
939209980 2:139162051-139162073 TCTGGGAAGGAATTACATTTGGG - Intergenic
939630155 2:144519793-144519815 CGTGGGTAGGAATTTCAGGTGGG - Intronic
940815431 2:158292301-158292323 CTTGGCAAGGAATACCAAGCAGG + Intronic
944388866 2:199196214-199196236 CTTGGGAAGGCCTTCCATGAGGG + Intergenic
945256476 2:207807551-207807573 CCTGGGAGGGAAATACATGTTGG - Intergenic
945704495 2:213212758-213212780 CTTAGGAAGCAAGTCCATTTTGG - Intergenic
946083354 2:217146871-217146893 CTTGGAAAGAACTTCCATATTGG - Intergenic
946574705 2:221062199-221062221 CTGGGGAACTCATTCCATGTGGG + Intergenic
948359761 2:237411988-237412010 CTTGGGAAGGAATTCCATGTTGG - Intronic
1170437397 20:16344731-16344753 ATTTGGAAGGATTTCCAAGTAGG - Intronic
1170975745 20:21162490-21162512 CTTGGGAAGGTGTTTCAGGTGGG + Exonic
1172959988 20:38792011-38792033 GTGGGGAAGGAGTTCCTTGTAGG + Intergenic
1175965381 20:62657623-62657645 CCTGGGAAGGAGTTTGATGTGGG + Intronic
1176116821 20:63435664-63435686 CCTGATAAGGAATTCCTTGTGGG - Intronic
1176616756 21:9032487-9032509 CTTGGGATGGATGTCCATCTGGG - Intergenic
1179367469 21:40771795-40771817 CTTGGAAAGGCATTCCAAATAGG + Intronic
1179493812 21:41759056-41759078 CTTGAGAATGCATTCCAGGTTGG + Intronic
1180682495 22:17638309-17638331 GTTGGGAAGGAATTCCGGGGAGG - Intronic
1183751987 22:39726366-39726388 CTGGGGAAAGAATTCCATCAGGG - Intergenic
1184542451 22:45136043-45136065 CTGGGCAGGGAATTCCAGGTGGG - Intergenic
949882069 3:8669699-8669721 CTTGGGGAAGAATGCCATGGTGG - Intronic
951057978 3:18170224-18170246 CTTCAGAAGTAACTCCATGTGGG + Intronic
951385187 3:22033048-22033070 CTTGGGCAGAAATTCAATCTCGG - Intronic
956077838 3:65525085-65525107 CTAGGGATGCAATTCCAAGTAGG - Intronic
956555170 3:70513564-70513586 CTTGGGATGGAATGGCAAGTTGG + Intergenic
959555931 3:107717618-107717640 AGTGGGAAGCATTTCCATGTAGG + Intronic
961113369 3:124304986-124305008 CTTAGGCAGAATTTCCATGTTGG + Intronic
961820337 3:129572660-129572682 CATGGGAATGACCTCCATGTAGG - Exonic
963735529 3:149014414-149014436 CTGGGGGAGGAATGCCATCTCGG + Intronic
964517911 3:157532702-157532724 CTTGGGAAAGAATTGAAGGTGGG - Intronic
966135834 3:176697247-176697269 CTTGGGAAAGAACTACATGTGGG + Intergenic
967249309 3:187520531-187520553 CTGGGTCAGCAATTCCATGTGGG - Intergenic
967767987 3:193303242-193303264 GGTGAGAAGGAATTCCAGGTGGG - Intronic
967855226 3:194112360-194112382 CTTGGGCTGGAAATCCAGGTAGG + Intergenic
969898225 4:10324477-10324499 CATGGGAAGCAGATCCATGTTGG + Intergenic
970701626 4:18747846-18747868 CTTGGGAAAGTATTAGATGTGGG - Intergenic
976730149 4:88253329-88253351 CTTGGGTGGGAATTCCATTTTGG + Intergenic
979423042 4:120530153-120530175 CTTTGGAAGGAAACACATGTGGG + Intergenic
980188522 4:129493876-129493898 TTTAGGAAGAAATTCTATGTTGG + Intergenic
983095652 4:163558277-163558299 CTTTTGAACGAATTCCATGAAGG - Intronic
983664997 4:170171533-170171555 CTTGGGAAGGGATTGAAAGTTGG + Intergenic
985193248 4:187400627-187400649 TATGGGAAGGAATTTCATGAAGG - Intergenic
986409410 5:7461963-7461985 CCTGAGAAGGAATGCCATGGAGG + Intronic
989380388 5:40804407-40804429 TTGGGGAAGGCATTCCAGGTAGG + Intergenic
989579249 5:43016738-43016760 CCTGGTAAGGAAATCCATTTTGG - Intergenic
991442032 5:66660695-66660717 CTTGGGAAGGATTTTAATTTGGG + Intronic
992589122 5:78275237-78275259 CTGGGTATGGAATTCTATGTTGG - Intronic
994334950 5:98553410-98553432 CTTGGGATAGAATTCTAAGTTGG + Intergenic
996328066 5:122298468-122298490 CTCGGGAAGGAATTCAAAGAAGG + Intergenic
996330779 5:122326175-122326197 CTTAGGAATGAATTTCTTGTAGG + Intronic
996823496 5:127655649-127655671 CTTGGGTATTAATTCCTTGTGGG - Intronic
1003029769 6:2592158-2592180 CTGGGGAAGCAATACCAAGTGGG + Intergenic
1004158995 6:13196834-13196856 CTTGCGAAAGACTTCCATGGCGG - Intronic
1011239476 6:85255795-85255817 ATGGGGAGGGAATTCCATGCAGG - Intergenic
1014694240 6:124598872-124598894 CTTGAGAAGGCATTGCATTTAGG - Intronic
1020088426 7:5323948-5323970 CTTGGGAAGGAGTTCCGTGTTGG - Intronic
1022880954 7:34586849-34586871 CTTTGGAAGGCATCCCATGTGGG - Intergenic
1023080793 7:36524331-36524353 CATGGGCATGAATTCCATGATGG - Intronic
1023516350 7:41005618-41005640 TGTGGGAAGAATTTCCATGTGGG + Intergenic
1025205886 7:56993164-56993186 CTTGGGAAGGAGTTCCGTGTTGG + Intergenic
1025666054 7:63583774-63583796 CTTGGGAAGGAGTTCCGTGTTGG - Intergenic
1027693025 7:81372285-81372307 CTTGGAAATGAAAACCATGTGGG - Intergenic
1028976147 7:96916448-96916470 CTTGGATAGTGATTCCATGTGGG + Intergenic
1034087576 7:148334267-148334289 CTTGGGAAGGAATTCACTCAAGG + Intronic
1035788559 8:2282545-2282567 AGTTGCAAGGAATTCCATGTGGG + Intergenic
1035804246 8:2439160-2439182 AGTTGCAAGGAATTCCATGTGGG - Intergenic
1041710154 8:60887034-60887056 AGTGAGAAGGAATTCTATGTGGG + Intergenic
1042569719 8:70149953-70149975 CATGGGGAGGAATTGTATGTCGG - Intronic
1043575783 8:81654461-81654483 TTTGGGAAGGATTGCCATCTGGG + Intergenic
1045792791 8:106004582-106004604 CTTTGGATGGAATTCCTTGGGGG + Intergenic
1047330200 8:123880119-123880141 CTTGGCAAGAAATTCCTCGTCGG + Intronic
1047351473 8:124078690-124078712 CCTGGGAAGGCATCCCAGGTGGG + Intronic
1047914348 8:129565849-129565871 GTTGGGAAGAAACGCCATGTGGG - Intergenic
1050962733 9:11757123-11757145 TTTGGGTAGCAATGCCATGTGGG + Intergenic
1053852618 9:42304146-42304168 CTTGGTCAGACATTCCATGTGGG - Intergenic
1054716206 9:68559918-68559940 CTTGGGAAGGAATTTATTCTTGG + Intergenic
1055353720 9:75416232-75416254 CTTGGGAAGCTATTCCCTGACGG - Intergenic
1055727843 9:79250760-79250782 CTTGGGAAGGAAGAGCATGTGGG - Intergenic
1056455314 9:86754032-86754054 CCTAGGATGGAATTCCATGCTGG + Intergenic
1057007455 9:91573172-91573194 CATGGGAAGGGATCCCATGCTGG + Intronic
1058443715 9:105034650-105034672 GTAGGGAAGGAACTCCATGGAGG + Intergenic
1059386583 9:113969445-113969467 CCTGGGCTGGAATTCCATCTGGG + Intronic
1059794647 9:117679569-117679591 CTTTGGAAGGCATTCCATTTAGG + Intergenic
1061259563 9:129472427-129472449 CTTGGGCTGGAGTTCCATGAGGG + Intergenic
1061421943 9:130477421-130477443 CTGGCGAAGGCTTTCCATGTGGG - Intronic
1062398105 9:136360659-136360681 CTTGGGAAGGATTTCCCTCCAGG + Intronic
1185695543 X:2191619-2191641 CTTGGGGAGGCCTTCCACGTTGG - Intergenic
1186984085 X:14992479-14992501 CTTGGAAATGAGTTCCATGGAGG - Intergenic
1187985649 X:24807850-24807872 CTGGGGAAGGAATTCCGGGTAGG + Intronic
1190738626 X:53272657-53272679 CTGGGAAAGGGATTCCAAGTAGG - Intronic
1192307412 X:69976728-69976750 CTTAGGAAGAAATTCAATGGAGG + Intronic
1193879844 X:86908487-86908509 TGTGGGAAGGAATCCCATGGAGG + Intergenic
1195204561 X:102583953-102583975 CTTAGGAAGAGATTCCGTGTGGG - Intergenic
1195829678 X:109042503-109042525 CTTGGGAAGTGATACCATGGTGG + Intergenic
1195966960 X:110437671-110437693 CTTGGGAATGAGTTCAATGCGGG + Intronic
1199690283 X:150304426-150304448 CTTGGGAAGGAAGTGCATCCAGG - Intergenic
1201150158 Y:11091338-11091360 CTTGGGATGGATGTCCATCTGGG - Intergenic