ID: 948359763

View in Genome Browser
Species Human (GRCh38)
Location 2:237412005-237412027
Sequence CTGAGTGGAGCAGAGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359763_948359767 -9 Left 948359763 2:237412005-237412027 CCCAAGCCCTCTGCTCCACTCAG 0: 1
1: 0
2: 1
3: 27
4: 318
Right 948359767 2:237412019-237412041 TCCACTCAGTGTCTGCTTCCTGG 0: 1
1: 0
2: 8
3: 67
4: 1020
948359763_948359771 18 Left 948359763 2:237412005-237412027 CCCAAGCCCTCTGCTCCACTCAG 0: 1
1: 0
2: 1
3: 27
4: 318
Right 948359771 2:237412046-237412068 TCTCGACCATGAGTGAGGAAAGG 0: 1
1: 1
2: 0
3: 3
4: 111
948359763_948359770 13 Left 948359763 2:237412005-237412027 CCCAAGCCCTCTGCTCCACTCAG 0: 1
1: 0
2: 1
3: 27
4: 318
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359763 Original CRISPR CTGAGTGGAGCAGAGGGCTT GGG (reversed) Intronic
900675271 1:3881363-3881385 TTGAGTGGAGCCCGGGGCTTGGG - Intronic
901056924 1:6452700-6452722 CTGAGTAGCCAAGAGGGCTTTGG + Intronic
901066275 1:6496236-6496258 CACAGTGCAGCAAAGGGCTTTGG + Intronic
901454532 1:9355502-9355524 CTGTGTGGAGAGGTGGGCTTGGG - Intronic
901769498 1:11523051-11523073 CAGAGTACAGCAGAGTGCTTCGG + Intronic
903420413 1:23214949-23214971 AGGAGAGGAGCAGAGGGCCTGGG + Intergenic
904612916 1:31735202-31735224 CTGAGCTGAGCAGGGGGCTGGGG + Exonic
904787605 1:32994415-32994437 CTGACTGGTACAGAGGCCTTGGG + Intergenic
904875340 1:33650521-33650543 CTGGCTGGAGCTTAGGGCTTAGG + Intronic
904964696 1:34362413-34362435 CCAAGTGGAGCAGTGGGATTGGG + Intergenic
904998287 1:34648277-34648299 CTGGCTGGGGCAGAGGCCTTGGG + Intergenic
905180106 1:36160297-36160319 CTGAAGGGAGCAGAGAGCCTGGG + Intronic
905742589 1:40385296-40385318 CTGAGGGGAAAAGAGGGCTATGG - Intronic
906023247 1:42650247-42650269 CTGAGGGGGGCAGATTGCTTGGG + Intronic
906301070 1:44682067-44682089 CTGAGCCGAGCACTGGGCTTGGG - Intronic
906460444 1:46032134-46032156 CTTAGTGGGTCAGAGGGCTTTGG - Intronic
907437591 1:54459372-54459394 CTGAGATGAGGAGATGGCTTGGG - Intergenic
907755959 1:57311090-57311112 CAAATTGGAGCAGTGGGCTTTGG - Intronic
908214320 1:61935115-61935137 CTATGGGGAGCAGAAGGCTTTGG + Intronic
909238417 1:73181278-73181300 CTCTGTGGAGCAGGAGGCTTGGG + Intergenic
909940749 1:81608946-81608968 CTCAAGAGAGCAGAGGGCTTTGG - Intronic
910556839 1:88543816-88543838 GTGATTGGAGCACAGGGGTTAGG - Intergenic
911717639 1:101152643-101152665 CTGAGAGGAGCATGGGGCCTGGG - Intergenic
911842150 1:102696658-102696680 CTGAGTGGGGCAGAGGTGTATGG - Intergenic
915127556 1:153676714-153676736 CTGAGTGAAGCAGGGTGCCTAGG + Intergenic
915308960 1:154997649-154997671 CAGAGTGGGAAAGAGGGCTTTGG + Intergenic
915855976 1:159386902-159386924 CTGTGTGGAGCCTAGGGATTTGG + Intergenic
916790149 1:168117826-168117848 CTGGCTGCAGCAGAGGGCCTGGG - Intronic
916848046 1:168673440-168673462 CTGAGTGGAGGGAAGGGATTTGG - Intergenic
919077539 1:192831432-192831454 CTGAGAAAAGAAGAGGGCTTTGG - Intergenic
919861659 1:201742704-201742726 CTCCCTGGGGCAGAGGGCTTCGG + Intronic
922972977 1:229758754-229758776 CTGCCTGAAGCAGAGGGCTTTGG + Intergenic
924732583 1:246724999-246725021 CGGAGAGGAGAGGAGGGCTTTGG + Intronic
1063441256 10:6075198-6075220 CAAAGTGGAGCAGAGGGTATGGG + Intergenic
1065241759 10:23712263-23712285 GTGAGGGGAGCATAGGGCTAGGG - Intronic
1065293881 10:24256990-24257012 CTGAGCAGAGCAAAGGGATTTGG + Intronic
1065380656 10:25086799-25086821 GTGAGTGTAGCAGTGGGGTTGGG + Intergenic
1065454392 10:25891920-25891942 CTGAGTGGTGGAGGTGGCTTTGG + Intergenic
1065696065 10:28380765-28380787 CTGAGTTGGGCAGATTGCTTGGG - Intergenic
1069731559 10:70618955-70618977 CGGAGGGGAGCAGTGGGTTTGGG + Intergenic
1069762328 10:70820345-70820367 CTGTGTGGAGCAGATGGGATAGG + Intronic
1069951081 10:72018548-72018570 CAGAGTGAAGCAGAGTGGTTTGG + Intergenic
1070281255 10:75050671-75050693 CAGCGTGGAGCGGAGGGCTCAGG - Intronic
1070741464 10:78906069-78906091 CTGCTTTGTGCAGAGGGCTTGGG - Intergenic
1072498719 10:95990256-95990278 CTGGGTGGAGGGGAGGGGTTGGG + Intronic
1076669507 10:132111842-132111864 CTGAGGGGAGCAGAGAGCAGTGG + Intronic
1077391470 11:2302449-2302471 CTGAGTGGGGCTGAGGCCTGGGG + Intronic
1078445886 11:11404593-11404615 CAGGGTGGGGCGGAGGGCTTAGG - Intronic
1078827426 11:14942511-14942533 CAGAGAGGAGTAGAGGGCCTGGG - Intronic
1078830812 11:14974542-14974564 CTGAGTGGGGCGTAGTGCTTGGG + Intronic
1081849393 11:46264883-46264905 CAAAGTGGAGCAGAGGGCTCAGG - Intergenic
1082811769 11:57482836-57482858 CGGAGTGGAACAGATGGCTGGGG - Intergenic
1083565138 11:63708130-63708152 CTGAATGGAGATGAGGGCTCTGG + Intronic
1083581162 11:63826533-63826555 CTGAGTGGGGCAGAGGTGATGGG - Intronic
1084271065 11:68029515-68029537 CTGAGGAGTGGAGAGGGCTTTGG - Intergenic
1084311958 11:68322234-68322256 CTGAGTGGAGGAGAGGGCAGGGG - Intronic
1085225702 11:74919056-74919078 CTAAGTGGAGAAGAGGGGTATGG - Intronic
1086857535 11:91883406-91883428 GTGAGTGGTGCAGAGATCTTGGG - Intergenic
1087730635 11:101774621-101774643 CTGAGTGGGGTAGAGGATTTAGG - Intronic
1088727983 11:112656354-112656376 GTGAGGGGAGGAGAGGGCTTGGG - Intergenic
1088853904 11:113729049-113729071 CTGAGTGGAGAAGTGCGGTTGGG + Intergenic
1089312815 11:117571233-117571255 TTGAGAGCAGCAAAGGGCTTTGG + Intronic
1089783936 11:120894727-120894749 CAGGGTGGAGCAAAGGGATTTGG + Intronic
1090258573 11:125302914-125302936 CTGTGTGGAGCAGCGAGCTAGGG - Intronic
1091145166 11:133273217-133273239 CTGAGTGAACCAGAGGGATGGGG + Intronic
1091557200 12:1582870-1582892 CTGAGGGCAGGAGAGGCCTTCGG - Intronic
1091820902 12:3474493-3474515 ATGACTGGAGCAGAGAGCATCGG - Intronic
1092522972 12:9292421-9292443 CTGCCTGGAGCAGAAGGCATGGG + Intergenic
1092544319 12:9439476-9439498 CTGCCTGGAGCAGAAGGCATGGG - Intergenic
1094508628 12:31082591-31082613 CTGCCTGGAGCAGAAGGCATGGG + Intronic
1095289044 12:40454544-40454566 CTCAGTGGGGCAGTGGGCTAGGG + Intronic
1095853849 12:46839533-46839555 CTCAGTGGAGCAGTTGCCTTAGG + Intergenic
1096100651 12:48968977-48968999 CTGAGAGGAGGAGAGAGGTTGGG + Intronic
1096478063 12:51920801-51920823 GTGAGTCGGGCAGAGGGGTTTGG - Exonic
1096610192 12:52795885-52795907 CGGAGCGGAGCAGGTGGCTTTGG - Exonic
1098313061 12:69166674-69166696 CTGAGCTTAGCAGAGGGCATTGG - Intergenic
1102742726 12:115222575-115222597 CTGTGTGGGGCACAGGGCTAGGG + Intergenic
1102905040 12:116667903-116667925 CTGAGGCGAGAAGATGGCTTGGG + Intergenic
1103041411 12:117698557-117698579 CTGAGTTGAGCAGATGGCTTGGG - Intronic
1104253888 12:127123511-127123533 TTGAGTGGAGCAGAGGGTGGGGG + Intergenic
1104747883 12:131221356-131221378 CTGAGTGTCGCAGAGGCTTTTGG + Intergenic
1104925566 12:132312484-132312506 CTGAGAGGACCAGAGTGGTTGGG + Intronic
1105346248 13:19575210-19575232 GTGAGTTGAGCAGAGGGGTTTGG + Intergenic
1106004177 13:25753118-25753140 CAGAGTGGAGGAGTGGGCATGGG + Intronic
1106012460 13:25837960-25837982 CTGAATGTGGCAGAGTGCTTGGG + Intronic
1107057939 13:36126966-36126988 CTGCAAGGAGCAGTGGGCTTTGG - Intronic
1107479404 13:40772811-40772833 GTGAGTTGAGCAGAGGGGTTTGG + Intergenic
1107782684 13:43921512-43921534 CTTTATGGAGCAGATGGCTTTGG + Intergenic
1108741854 13:53346579-53346601 CTGAGGAGAGCAGGGGACTTGGG - Intergenic
1114668688 14:24397736-24397758 CAGGGTGGAGCAGAAGGCTTTGG + Intergenic
1115214458 14:31001026-31001048 CTGAGTGAGGCAGAGGGGGTAGG + Intronic
1116455096 14:45111098-45111120 CTAAGTAGAACAGAGGACTTGGG + Intronic
1118840091 14:69503374-69503396 CTAAATGAAGAAGAGGGCTTCGG - Intronic
1119647092 14:76355833-76355855 CTGATTGGAGCAGGAGGCTGAGG - Intronic
1119924149 14:78475670-78475692 CTGATTGTAGCAGAGGTGTTTGG - Intronic
1121069271 14:91001871-91001893 ATGTGGGGAGCAGAGTGCTTTGG + Intronic
1121702944 14:95970048-95970070 CTCAGTGAAACAGAGGGCCTGGG - Intergenic
1121877241 14:97464430-97464452 CTGAGGGTAGAAAAGGGCTTGGG + Intergenic
1122301307 14:100732692-100732714 CTCAGTGGGGAAGGGGGCTTTGG + Intronic
1122393696 14:101407851-101407873 CTGGGTGGAACAGAGGGATGTGG + Intergenic
1122561055 14:102614681-102614703 CTTAGTGGAGCTGAGAGGTTGGG + Intronic
1122580958 14:102771311-102771333 CTGAGTGGAGCAGGCTGCTGAGG + Intergenic
1123153218 14:106202317-106202339 CTGAGTAGAGTATAGGGATTAGG + Intergenic
1124347756 15:28933883-28933905 ATGGGCGGAGCAGAGGGCCTGGG + Intronic
1124630932 15:31336737-31336759 GGGAGTGGGGCAGAGGGCATGGG + Intronic
1124645622 15:31436081-31436103 CTGGGTGGAGCAGAGTGATCAGG - Intergenic
1125762298 15:42104927-42104949 CTGAGTGAGGAAGAGGGCTTAGG - Intergenic
1125796948 15:42410194-42410216 CTGAGAGAAGCACAGGGGTTAGG - Intronic
1128622487 15:69161568-69161590 CTGAGGGCGGGAGAGGGCTTTGG + Intronic
1128768524 15:70265501-70265523 CTGGAGGGAGCAGGGGGCTTGGG + Intergenic
1129169865 15:73801058-73801080 CTGAGTGGAGCCCAGGGCTCAGG + Intergenic
1129733035 15:77942631-77942653 CTGAGTGGAGGAGGGGTGTTGGG - Intergenic
1130232193 15:82105544-82105566 CTGACTGGAGCTGTGGCCTTGGG + Intergenic
1130232651 15:82108674-82108696 CAGAGGGGAGCAGAGAGCTGGGG + Intergenic
1130559419 15:84946743-84946765 CCTAGTGGCACAGAGGGCTTGGG - Intergenic
1131174094 15:90199368-90199390 ATGAGAGGAGCTGAGGGTTTTGG + Intronic
1131249203 15:90819652-90819674 AGGAGTGGAGCAGAGAGCTCAGG + Intergenic
1131905130 15:97134554-97134576 CTGAGTAGAAGAGAGGGCTATGG + Intergenic
1133230107 16:4362368-4362390 CTTGGTGGAGCCCAGGGCTTTGG + Intronic
1133370499 16:5242431-5242453 CTGTGGGCAGCAGTGGGCTTTGG - Intergenic
1134000932 16:10782260-10782282 CTGTGTGCTGAAGAGGGCTTTGG - Intronic
1134789205 16:16973245-16973267 CTGAGTGGGGCAGATGGCCATGG + Intergenic
1136417042 16:30110532-30110554 CAGAGGGGAGCAGAGAGCTCTGG + Intronic
1138091006 16:54174572-54174594 CTGTGGGCAGCAGAGGGCTTGGG + Intergenic
1138955091 16:61961872-61961894 CTGTGTGGAGAATGGGGCTTCGG - Intronic
1139516023 16:67452825-67452847 CTGAGTGGAGGAAAGGACCTTGG - Intronic
1139596385 16:67960724-67960746 CTCAGTGTAGCTGAGGGCTGGGG - Intronic
1141237283 16:82230198-82230220 CAGAGGGCAGCAGAGAGCTTAGG - Intergenic
1141624363 16:85253531-85253553 CTGGGTGTTGCAGAGGGATTGGG + Intergenic
1142129749 16:88427303-88427325 GTGAGTGGGGCAGAGGGGCTGGG - Intergenic
1143795113 17:9330019-9330041 CAGAGGGGAGCAGAGGGCAGAGG + Intronic
1143927099 17:10381416-10381438 CTGACAGTGGCAGAGGGCTTTGG + Intergenic
1144357079 17:14456458-14456480 CTGACTGGAGCAGAGAGCGGAGG - Intergenic
1144742599 17:17592211-17592233 ATGAGTGGAGGAGGGGTCTTTGG - Intergenic
1146263477 17:31436412-31436434 CAGAGTGGAGCCGAGGCCTGGGG + Intronic
1146374742 17:32286419-32286441 CTGAGTAGAGCAGAGAGCTGAGG + Intronic
1146419140 17:32665987-32666009 CTTAGTGGAGGAGAGGGGTCAGG - Intronic
1147448374 17:40488754-40488776 CTGAGGGGGGCAGAGGGCGCTGG + Exonic
1148195883 17:45712404-45712426 CTGAGTGGAGTGGGGGCCTTGGG - Intergenic
1148861997 17:50609364-50609386 CTGAGCCGAGCAGAAGGCCTTGG - Intronic
1148990748 17:51665006-51665028 CTGAGTGAATAAGATGGCTTTGG - Intronic
1148994786 17:51700335-51700357 CTGAGTGGGGTGGAGAGCTTTGG - Intronic
1149346941 17:55748415-55748437 CTGCTTGGAGAACAGGGCTTGGG + Intergenic
1150578498 17:66451678-66451700 GTGGGTGGAGCAGAGGGAGTGGG + Intronic
1151458575 17:74241411-74241433 CGGAATGGAGCCGGGGGCTTTGG - Intronic
1151894198 17:76969150-76969172 CCGAGCGGAGCAGCGGGCTCCGG + Intergenic
1153733706 18:8043007-8043029 CTGTGGGGAACAGAGGGCTGAGG - Intronic
1156267350 18:35500705-35500727 CTGAGAAGAGCAGAGGGCCTTGG - Intergenic
1156357197 18:36351906-36351928 CTAAGAAGAGCACAGGGCTTAGG + Intronic
1158250901 18:55486356-55486378 CTGAGGTGGGCAGATGGCTTGGG + Intronic
1160402175 18:78619125-78619147 CTGAGTGGACTTTAGGGCTTTGG - Intergenic
1160434552 18:78836391-78836413 CTGAGTGGAGGGGAGTCCTTTGG - Intergenic
1160915421 19:1494234-1494256 CTGGGTGGAGGAGAGCCCTTTGG - Intronic
1161162228 19:2767898-2767920 CTGAGAGCAGCAGAGGCCGTGGG + Intronic
1161325003 19:3659313-3659335 CTGAGATGAGCAGAAGGATTCGG + Intronic
1161818494 19:6515212-6515234 GTCAGGGGAGCAGAGGGCTTTGG + Intergenic
1162100874 19:8337941-8337963 CTGGGTGGAGGAGAGCTCTTGGG - Intronic
1164661726 19:29978378-29978400 CTGACTGAGGCAAAGGGCTTAGG + Intronic
1164762159 19:30736259-30736281 CTGATTGGTCCAGAGGTCTTGGG - Intergenic
1165097449 19:33417340-33417362 CTCAGCTGGGCAGAGGGCTTAGG + Intronic
1166850165 19:45756103-45756125 GTGAGTGGTGCTGAGGGGTTTGG + Intronic
1166967293 19:46536841-46536863 CTGAGTTGGGGAGAGGGGTTGGG - Intronic
1167101072 19:47404642-47404664 CTGCCTGGAGGAGAGGACTTTGG - Intronic
1167234937 19:48308727-48308749 CTCTGTGGAGCAGAAGGCCTGGG - Intronic
1168724620 19:58573954-58573976 CTGAGTGGATCAGAGGGTCAGGG + Intergenic
925188854 2:1867185-1867207 CTGAGTGGAGAAAAGGGTGTGGG + Intronic
925839282 2:7976129-7976151 CAGAGTGGAGGAGAGGTCCTGGG + Intergenic
925855643 2:8126578-8126600 CACAGTGGAGCAGAGAACTTGGG - Intergenic
926002834 2:9347606-9347628 CTGATTGGAGCAGAGGATTGAGG + Intronic
928363448 2:30683962-30683984 TGGAGTGGAGCGGAGGGCTCAGG - Intergenic
928880007 2:36087371-36087393 GTGAGAAGAGCAGAAGGCTTGGG - Intergenic
930100024 2:47596282-47596304 CTGAGTGGAGAGGGGGGCTGGGG + Intergenic
931427218 2:62182235-62182257 CTGAGAGAAGCAGAGGGCCTAGG - Intergenic
932596067 2:73094281-73094303 CTGACTGGGGCACTGGGCTTAGG + Intronic
933942245 2:87254363-87254385 CTGGGTAAAGCAGAGGGCTGGGG - Intergenic
936337980 2:111607206-111607228 CTGGGTAAAGCAGAGGGCTGGGG + Intergenic
936665118 2:114586012-114586034 CTGAGGTGAGCAGATTGCTTGGG + Intronic
936918212 2:117661568-117661590 ATGAATTGAGCAGAGGGCCTGGG + Intergenic
937361789 2:121234853-121234875 CTGAGGGGAGCTGTGGACTTGGG - Intronic
938016703 2:127873255-127873277 CTGAGACCAGTAGAGGGCTTGGG + Intronic
942749992 2:179276573-179276595 CTGGGTGGGGCAGAGGGTTGGGG + Intergenic
943427388 2:187752996-187753018 CTGTGTGCAGCAGAGGGACTTGG - Intergenic
944964094 2:204909709-204909731 ATGAGTGGAGCACAGAGTTTCGG + Intronic
945419760 2:209620353-209620375 TTCAGTGGAGCAGAGAACTTGGG - Intronic
946201499 2:218073258-218073280 CTGGGCAGAGCAGAGGGCTCCGG - Exonic
946404508 2:219485136-219485158 GTGGGAGGAGCAGAGGGCTGGGG + Intronic
948215671 2:236228350-236228372 CTGAGTGGAGGAGACGGCACTGG + Intronic
948359763 2:237412005-237412027 CTGAGTGGAGCAGAGGGCTTGGG - Intronic
1168829931 20:840329-840351 CTGAGTGTGGCAGAGGGCTGGGG + Intronic
1170830254 20:19833656-19833678 GTGAGTGTAGCAGTGCGCTTGGG + Intergenic
1173408009 20:42783952-42783974 GGGAGTGGAGCAGAGGGCCCAGG + Intronic
1174821068 20:53726840-53726862 TTGAGTGGGGCACTGGGCTTCGG + Intergenic
1175464619 20:59182136-59182158 CTGCGTGGATTAGATGGCTTAGG + Intergenic
1175922981 20:62458697-62458719 CTGTGTGGAGGAGGGGGCGTGGG + Intergenic
1175999838 20:62826868-62826890 CTGAGAGGAGCAGAGGGAAAGGG - Intronic
1176029340 20:63004029-63004051 CTGAGTGGAGTGGAGTGTTTCGG - Intergenic
1176906639 21:14509589-14509611 CTGAGCAGAGCAAAGGCCTTGGG - Intronic
1179485099 21:41705024-41705046 CTGAGCGGTGCAGAGGACTCAGG + Intergenic
1179893656 21:44350130-44350152 CTGAGTGACGCAGAGCGCTGCGG + Intergenic
1180117062 21:45715229-45715251 ATCAGTGGAGTATAGGGCTTCGG + Intronic
1181660981 22:24348564-24348586 CTGAGGGGAGAAAAGAGCTTAGG - Intronic
1181894334 22:26093596-26093618 CCGCCTGGAGCAGAGGGCTGGGG + Intergenic
1181980013 22:26759637-26759659 CTCAGTGGGGCAGGGGGCTTTGG + Intergenic
1182573009 22:31253053-31253075 CTGAGGGGTTCTGAGGGCTTGGG - Intronic
1183072155 22:35403565-35403587 CTGCATGGTGCAGAGGGCTTTGG + Intronic
1183263566 22:36811860-36811882 AGGAGTGGAGCAGAGGGTATTGG - Intronic
1184451370 22:44584646-44584668 CTGCCTGGAGGAGAGGGTTTTGG + Intergenic
1185179350 22:49350216-49350238 CAGGGTGGGGCAGCGGGCTTAGG + Intergenic
1185360228 22:50402293-50402315 CTGAGTTGGGAAGAGGGCTGGGG + Intronic
949590413 3:5488144-5488166 CTGAGTGGGGCAGAGGGTGGTGG + Intergenic
949905647 3:8856263-8856285 CTGAGGTGAGCAGTGGGCATGGG - Intronic
950432049 3:12956410-12956432 CCCAGTGGAGCAGAAGGCCTTGG - Intronic
950520220 3:13493705-13493727 CTCAGCGGAGCAGCAGGCTTCGG - Intronic
950653688 3:14423586-14423608 CTGAGAGGAGCAGAGGCCTGAGG - Intronic
950675417 3:14551428-14551450 CAGAGTGGAGCCCAGGGCCTGGG - Intergenic
951960805 3:28317942-28317964 CTGAGGGGAGGAGAGGGGCTAGG + Intronic
952236193 3:31482505-31482527 AGGAGTGTAGGAGAGGGCTTGGG - Intergenic
952382296 3:32815238-32815260 CTGGGGGCAGCTGAGGGCTTAGG + Intergenic
952408988 3:33030664-33030686 CTGAGTGGTGAAGAGGGGATGGG - Intronic
952746622 3:36787800-36787822 CTGAGTAGGGCAGAGGGCAGAGG - Intergenic
953030269 3:39175341-39175363 CTGACAGGAGCTGAGGCCTTTGG - Intergenic
954647998 3:52143232-52143254 CTGAGTGGAGCTGAGTGTGTGGG - Intronic
954800425 3:53183910-53183932 CTAAGTGAAGCAGAGGGCAGGGG - Intronic
956907707 3:73783658-73783680 CTCAGTTTAGCATAGGGCTTGGG - Intergenic
961053560 3:123767656-123767678 CTTAGTGCAGCAAAGGCCTTAGG - Intronic
961468757 3:127098123-127098145 CTGAGTGGTCTAGAGGGCTAAGG + Intergenic
962057563 3:131888037-131888059 CTGAGAGGACCAGAAGGCTGGGG - Intronic
962189239 3:133292704-133292726 CTGAGAAAAGGAGAGGGCTTTGG - Intronic
964185282 3:153934914-153934936 CTGATTGGAGCAGGGGGCAGAGG + Intergenic
964363390 3:155922614-155922636 CTCAGAGGAGCAGACAGCTTTGG - Intronic
966873622 3:184308576-184308598 CTGAGTAGAGGGGAGGGCTCAGG + Intronic
967372929 3:188769363-188769385 CTAAGATGAGCAGAGGGCTGGGG - Intronic
969220767 4:5757001-5757023 CTGGGAGGAGGAGAGGGCCTGGG + Intronic
969301369 4:6299272-6299294 CCAAGAGGAGCAGAGGGCTGAGG - Intronic
969410085 4:7022271-7022293 CTGACTGGGGCAGAGGGCCTGGG + Intronic
969626347 4:8307669-8307691 CTGGGTGGAGCAGAGGGTTGGGG - Intergenic
978120725 4:105076035-105076057 CTGATTGGAGAAGATGGCTTGGG - Intergenic
978400024 4:108321599-108321621 CTAAATGGAGTAGAGGGCTAAGG - Intergenic
979383712 4:120038938-120038960 CACAGTGCAGCATAGGGCTTAGG - Intergenic
980101671 4:128547523-128547545 CTGAGTGTTGGAGAGGGGTTGGG + Intergenic
982125898 4:152183567-152183589 CTGAGCTGAGCAGAGGGGGTGGG + Intergenic
983647304 4:170004808-170004830 CTGTGTGAAGTAGAGGGGTTGGG - Intronic
984683659 4:182641002-182641024 CTGTGAGAAGCAGAGGGCTGTGG - Intronic
984702605 4:182827816-182827838 CTCAGAGGAGCAGAGGGGTTGGG + Intergenic
985906957 5:2846226-2846248 CTGAGTGGAGCAAAAGGCAGAGG - Intergenic
987275848 5:16361710-16361732 CTGAGGGGATGAGAAGGCTTAGG + Intergenic
989485977 5:41992335-41992357 TTTAGTGGATCAGAGGACTTTGG + Intergenic
990831545 5:59964518-59964540 CTGAGTAGAGAAGAGAGCCTAGG - Intronic
993812187 5:92494733-92494755 CTGAGTTGAGCATTGTGCTTGGG + Intergenic
994191023 5:96869564-96869586 CTGTCTGGAACAAAGGGCTTGGG + Intronic
994256377 5:97601040-97601062 CTCTGTGAAGAAGAGGGCTTGGG - Intergenic
995973798 5:118006448-118006470 TTAAGTGGAGCAGAGGGAGTGGG - Intergenic
997201670 5:132013442-132013464 CTGAGTGCCGCAGAGGCCTGAGG - Intergenic
997249576 5:132378044-132378066 CTGAGCGGAGCCCAGGGCTGTGG - Intronic
1001020037 5:168174973-168174995 CTAAGTGGGGCAGGGGGCATGGG - Intronic
1002042636 5:176525996-176526018 CTGACTGGATCAGGGGGCTCAGG - Intergenic
1002079831 5:176730925-176730947 CTGTGTGGAGCAGAGTGCCCTGG + Intergenic
1002602696 5:180363050-180363072 CTGAGTCTAGCAGAGGCATTTGG + Intergenic
1002645174 5:180649332-180649354 CTGAGGGGAGCACGGCGCTTGGG - Intronic
1002904620 6:1438555-1438577 CACAGTGGAGCTCAGGGCTTTGG - Intergenic
1003058452 6:2843122-2843144 TTTAGTGGAGCAGTGGGATTGGG - Intergenic
1004057068 6:12150138-12150160 TGCAGTGGAGCAGAGGGATTAGG - Intronic
1004381348 6:15135252-15135274 GTGGGTGGAGCAGATGGCTCAGG - Intergenic
1006428347 6:33980060-33980082 CTGTGTGGAGAGGAGGCCTTGGG + Intergenic
1006781823 6:36637345-36637367 TGGAGTGGAGGAGGGGGCTTGGG - Intergenic
1006804116 6:36777437-36777459 CTGGGAGGAGGAGAGGGATTTGG - Intronic
1007932946 6:45708798-45708820 GTCTGGGGAGCAGAGGGCTTGGG + Intergenic
1008883747 6:56409904-56409926 CTGAGAGGGAAAGAGGGCTTGGG - Intergenic
1011239694 6:85257873-85257895 CTCACTGGAGCAAAGGGCATGGG - Intergenic
1011441168 6:87388774-87388796 CTGAGTGGATCAGATGTCTGGGG + Intronic
1011506105 6:88045922-88045944 CAGAGTGGGGCAGAGGAGTTTGG + Intergenic
1012029874 6:94045515-94045537 CTGAATGGAACAGGGGGGTTGGG - Intergenic
1014220417 6:118793676-118793698 TTCAGTGGTGCAGAGGGCTCAGG - Intergenic
1016230860 6:141802133-141802155 GTGAGTGGAGCACAGGATTTGGG + Intergenic
1016455321 6:144224677-144224699 CTGGGTGGAGAAGCCGGCTTGGG + Intergenic
1017125177 6:151058309-151058331 CTGAGTGGAGGAGGTGGCGTGGG + Intronic
1017593694 6:156005685-156005707 CTGAGTGGATCAGGGGACTGTGG - Intergenic
1017722945 6:157256891-157256913 CTGTGTGTGGCCGAGGGCTTGGG - Intergenic
1018783301 6:167088751-167088773 CTGAGATGGGCAGATGGCTTGGG + Intergenic
1019060174 6:169251838-169251860 CTGGGGGGAGCAGATGGTTTGGG - Intronic
1019215810 6:170443187-170443209 CAGAGTGGAGGAACGGGCTTGGG + Intergenic
1022471377 7:30683512-30683534 CTGAGTGGGGCATTGGGCTCGGG + Intronic
1024640218 7:51322381-51322403 CTGGCTGGAGAAGAGGACTTTGG - Intergenic
1026085246 7:67257962-67257984 CTCAGTAAATCAGAGGGCTTGGG + Intergenic
1026370586 7:69694543-69694565 CTGAGATGGGCAGATGGCTTGGG + Intronic
1026445013 7:70476499-70476521 CTGTGTGGGGCAGATGTCTTTGG - Intronic
1026691925 7:72556932-72556954 CTCAGTAAATCAGAGGGCTTGGG - Intergenic
1028119103 7:87037128-87037150 CTGTGTTGAGGAGAGTGCTTAGG - Intronic
1028185328 7:87778206-87778228 CTGAGTTGGGCAGATTGCTTGGG + Intronic
1028808588 7:95058462-95058484 CTGAGAAGAGAAGAGGGCTGTGG + Intronic
1034489680 7:151386610-151386632 CTGGGTGGTGCAGATGGCTGAGG - Intronic
1034941827 7:155235722-155235744 CACAGTGGAACAGAGGGCTAAGG + Intergenic
1035647905 8:1242586-1242608 AGGAGTGGCGCAGAGGGCTCAGG - Intergenic
1036181441 8:6588759-6588781 GAGAGAGGAGCAGAAGGCTTGGG - Intronic
1037401523 8:18499331-18499353 CTAACTGGAGCAGAGGGGCTGGG + Intergenic
1038532711 8:28331506-28331528 CTGGGAGGAGCAGAAGGCCTGGG - Intronic
1039419298 8:37422097-37422119 CTCAGTGGAGCAGAGTGCCTGGG + Intergenic
1039478251 8:37852910-37852932 CTGAGAGGAGCCCAGGGCTGAGG - Intergenic
1039588092 8:38723706-38723728 GCGTGGGGAGCAGAGGGCTTGGG - Intergenic
1039781761 8:40793077-40793099 CTGAGCGCAACAGTGGGCTTTGG + Intronic
1041548264 8:59071208-59071230 AAGAGTGGGGCAGAGGGCTTTGG + Intronic
1042209460 8:66365123-66365145 CAGAGAGGAACAAAGGGCTTAGG - Intergenic
1043456153 8:80414354-80414376 CTGAGAGGAGGAGGGGGCTGGGG + Intergenic
1045147376 8:99362020-99362042 CAGAGAGGAGCAGAAGACTTTGG - Intronic
1045668147 8:104513785-104513807 GTGAGAAGAGCAGAGGGCTTTGG - Intronic
1046116712 8:109793277-109793299 CTGGGAGGAGCAGAGAGGTTGGG + Intergenic
1046526160 8:115384634-115384656 CTGATTGGAGTAGAGTGCTGGGG - Intergenic
1046618873 8:116506755-116506777 CTGAGTTGAAGGGAGGGCTTGGG + Intergenic
1047700544 8:127445356-127445378 ATGAGTGGAGCAGAAGCCTGAGG - Intergenic
1048059022 8:130898320-130898342 CTGACAGGAGTAGAGAGCTTCGG - Intronic
1048630335 8:136235266-136235288 CTGAGAGGATCAGATGTCTTGGG - Intergenic
1048844182 8:138591314-138591336 GTGAGCGGAGAGGAGGGCTTAGG - Intronic
1049577741 8:143397448-143397470 CTGAGTGGGACACTGGGCTTGGG - Intergenic
1049969281 9:807466-807488 CAGAGTGGAGAAGAGGGCACAGG - Intergenic
1050758138 9:9033390-9033412 CTGAGTGGAGCAGCGGAAATAGG - Intronic
1050925621 9:11259557-11259579 TTGATTGGAGGAGAGGGCTCAGG + Intergenic
1051342944 9:16128400-16128422 CAGAGAGGAGCAGAGGGCTCTGG - Intergenic
1054706247 9:68465181-68465203 CTGTGTGGGGAAGAGAGCTTTGG + Exonic
1054834063 9:69658052-69658074 TGGTGTGGAGCAGAGGGCTGGGG - Intronic
1055932527 9:81574112-81574134 CTGTGTGGACCAGCGGGATTAGG - Intergenic
1056293973 9:85173058-85173080 CTGAGGGGTGCATAGGACTTTGG + Intergenic
1059022395 9:110590701-110590723 ATGTGGGGAGCAAAGGGCTTAGG - Intergenic
1059935843 9:119309790-119309812 CTGGGTGGAGGAGGGGGCGTGGG + Intronic
1061158108 9:128877329-128877351 CTGAGTTCAGCAAAGGGCCTGGG - Intronic
1061824415 9:133248855-133248877 CTGAGTGCAGCAGAGAGCAGCGG + Intergenic
1062255508 9:135618992-135619014 CTGAGGGCAGCAGAGGGGTGAGG - Intergenic
1062614271 9:137388962-137388984 CTGAGGGGAGCTGAGGCCGTGGG - Intronic
1187567702 X:20468559-20468581 CGGAGAGCAGCAGAGGGCCTGGG + Intergenic
1187944450 X:24412622-24412644 CTGACTGCAGCAGAGTGCCTTGG - Intergenic
1187981199 X:24759411-24759433 CTATGTAGAGCACAGGGCTTAGG - Intronic
1189213773 X:39306059-39306081 CTGAGTGGACCACAGGGATGTGG + Intergenic
1189579710 X:42393405-42393427 CTGAGCAGAGCAGAGGCCTAAGG - Intergenic
1191713695 X:64179284-64179306 CTGAGGTGGGCAGAGAGCTTGGG + Intergenic
1191714153 X:64182603-64182625 CTGACTGGGGGAGAGGGCCTTGG + Intergenic
1194729629 X:97438608-97438630 CTGAGGCGGGCAGATGGCTTGGG - Intronic
1194985391 X:100484621-100484643 GTCAGTGGAGCTGAGGGCTATGG + Intergenic
1195718693 X:107844226-107844248 CAAAGTGGATTAGAGGGCTTGGG + Intronic
1196520806 X:116668480-116668502 CTGAAAGCAGCAGAGGGATTTGG + Intergenic
1196730574 X:118937728-118937750 CTGGCTGGAGTAGAGGACTTTGG + Intergenic
1197441262 X:126494210-126494232 CTGAATAGAGCAGAGGGCCCTGG - Intergenic
1199359440 X:146901666-146901688 CTGAGTGGGGCAGAGTTTTTGGG + Intergenic
1199623624 X:149720923-149720945 TTTATTGGAGGAGAGGGCTTAGG - Intergenic
1199723329 X:150558806-150558828 CTGAGTGGAGAGGAGGGGTCTGG + Intergenic
1200078574 X:153564431-153564453 CTCAGTGGGGCAGGGGGCTGGGG - Intronic
1200235057 X:154464134-154464156 CTGGGGGAAGCAGAGGGCTCAGG - Intronic
1200912809 Y:8546102-8546124 CTGAGTTGTGCAGTGGTCTTTGG - Intergenic
1201115049 Y:10829047-10829069 TTGAGTGGAGTGGAGGGGTTTGG - Intergenic