ID: 948359764

View in Genome Browser
Species Human (GRCh38)
Location 2:237412006-237412028
Sequence ACTGAGTGGAGCAGAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 371}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359764_948359771 17 Left 948359764 2:237412006-237412028 CCAAGCCCTCTGCTCCACTCAGT 0: 1
1: 0
2: 2
3: 35
4: 371
Right 948359771 2:237412046-237412068 TCTCGACCATGAGTGAGGAAAGG 0: 1
1: 1
2: 0
3: 3
4: 111
948359764_948359767 -10 Left 948359764 2:237412006-237412028 CCAAGCCCTCTGCTCCACTCAGT 0: 1
1: 0
2: 2
3: 35
4: 371
Right 948359767 2:237412019-237412041 TCCACTCAGTGTCTGCTTCCTGG 0: 1
1: 0
2: 8
3: 67
4: 1020
948359764_948359770 12 Left 948359764 2:237412006-237412028 CCAAGCCCTCTGCTCCACTCAGT 0: 1
1: 0
2: 2
3: 35
4: 371
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359764 Original CRISPR ACTGAGTGGAGCAGAGGGCT TGG (reversed) Intronic
900116815 1:1032637-1032659 ACCGAGTGTGGCAGATGGCTTGG + Intronic
900799640 1:4729257-4729279 AGTGAGGGGAGCACAGGGCAGGG + Intronic
901454533 1:9355503-9355525 ACTGTGTGGAGAGGTGGGCTTGG - Intronic
903010113 1:20323801-20323823 ACTGAGTGGAGCAGGGCACAGGG + Intronic
903877480 1:26485364-26485386 CCTCAGAGGAGCAGAGGGATAGG - Intergenic
904257809 1:29267502-29267524 ACTGAGCCGTGCAGAGAGCTGGG + Intronic
904439391 1:30520440-30520462 ACTGAGGGCAGAAGAGGGCTGGG + Intergenic
904597688 1:31657150-31657172 TCTGGGTGGAACAGGGGGCTGGG - Intronic
904612915 1:31735201-31735223 GCTGAGCTGAGCAGGGGGCTGGG + Exonic
904617829 1:31759544-31759566 ACTGAGGGGAGGAGGGGGGTTGG - Intronic
905271819 1:36792405-36792427 ACTGAATGCAGCACAGGCCTCGG - Intergenic
905447921 1:38039267-38039289 ACAGAGTGGGGCAGAGGGATGGG + Intergenic
906141244 1:43534969-43534991 AGTGTGTGTAGCACAGGGCTTGG + Intronic
906149362 1:43578519-43578541 ACTGAATGGAGCTGGGGGTTGGG + Intronic
906481585 1:46203014-46203036 ACAGAGAGCTGCAGAGGGCTTGG - Intronic
907455251 1:54571667-54571689 CCTGAGCGGAGCAGAGAGGTGGG - Intronic
907516053 1:54994139-54994161 ACTGGTTGGAGCAGAGAGCAGGG - Intergenic
909032269 1:70556379-70556401 ACTGAGGGGACGAGAAGGCTTGG - Intergenic
909872459 1:80759934-80759956 ACGTAGTTGAGAAGAGGGCTTGG - Intergenic
910499496 1:87873270-87873292 ACTGTTAGGAGCAGAGGCCTGGG + Intergenic
912410492 1:109477796-109477818 CCTGGGAGGAGCAGAGGGATGGG - Exonic
913136350 1:115893213-115893235 ACTGAGTGTGGCAGAGGCATAGG + Intergenic
914872393 1:151485943-151485965 CCAGAGGGGAGCAAAGGGCTTGG + Intergenic
915287944 1:154864752-154864774 ACAGAGAGGAGCAGAGGGGCAGG + Intronic
915484102 1:156208106-156208128 ACTGACTGGACTAGAGGGCCAGG - Intronic
917630521 1:176887107-176887129 AGTGGGAAGAGCAGAGGGCTGGG - Intronic
917853013 1:179081609-179081631 GCTGAGTGGAGAAGAGGCCCTGG - Exonic
917981367 1:180271716-180271738 CCTGAATGGAGCACAGGTCTGGG - Intronic
919857138 1:201713635-201713657 TCCAAGTGGGGCAGAGGGCTGGG + Intronic
920690197 1:208140472-208140494 ACTGTGTGTAGCAGAGGACCAGG - Intronic
921402000 1:214734858-214734880 ACTTAGAGGAGCAAAGGTCTAGG + Intergenic
922402408 1:225273822-225273844 ACTGAATGGAGCAGTGATCTAGG + Intronic
922779405 1:228239916-228239938 CGTGGGTGGAGGAGAGGGCTGGG + Intronic
923259230 1:232251050-232251072 ACAGAGTGGAGCCGAGGACAAGG + Intergenic
1063164185 10:3444920-3444942 GGTGAGCTGAGCAGAGGGCTAGG + Intergenic
1063380674 10:5583643-5583665 AAGGAGTGGAGGGGAGGGCTCGG - Intergenic
1063409949 10:5829897-5829919 ACTGATAGGAGCAGATGGCTGGG + Intronic
1063831994 10:9963874-9963896 ACTCACTGGGGCTGAGGGCTGGG + Intergenic
1065241760 10:23712264-23712286 GGTGAGGGGAGCATAGGGCTAGG - Intronic
1065380655 10:25086798-25086820 AGTGAGTGTAGCAGTGGGGTTGG + Intergenic
1065542711 10:26785900-26785922 CCTCTGTGGAGCAGTGGGCTTGG + Intronic
1067475638 10:46564146-46564168 AGGGAGTGGAGCAGAGTCCTTGG - Intergenic
1067491996 10:46717411-46717433 ACTCAGAGGAGCAGAATGCTGGG + Intergenic
1067602661 10:47622970-47622992 ACTCAGAGGAGCAGAATGCTGGG - Intergenic
1067619098 10:47777629-47777651 AGGGAGTGGAGCAGAGTCCTTGG + Intergenic
1068482007 10:57602945-57602967 ATTGAGTGGAGAAGAGGCCAAGG + Intergenic
1069639344 10:69944858-69944880 ACTGCATGGAACAGAGGGCCAGG + Intronic
1069909882 10:71752529-71752551 CCAGAGTGGTGCAGTGGGCTGGG - Intronic
1070621585 10:78016388-78016410 AATAAGTGGAGCTGAGGTCTTGG - Intronic
1070681250 10:78450983-78451005 AGGGAGTGAAGCAGAGGGTTAGG + Intergenic
1071654018 10:87428380-87428402 ACTCAGAGGAGCAGAATGCTGGG - Intergenic
1073430128 10:103480557-103480579 TCTGAGCGGAGGAGAGGGCGGGG + Intergenic
1074472552 10:113740710-113740732 AATGAGTGGAGCAGGGAGCGAGG + Intergenic
1075199711 10:120392339-120392361 ACTGACTGGGGCAGAGGGTGGGG + Intergenic
1076106000 10:127824159-127824181 ACAGAGTGGGGCAGAGGGGCTGG + Intergenic
1076322848 10:129596254-129596276 ACTGAGTTGGGGAGGGGGCTGGG - Intronic
1077056016 11:593570-593592 CGTGAGTGGAGCAGAGGCCTGGG - Intronic
1077391469 11:2302448-2302470 CCTGAGTGGGGCTGAGGCCTGGG + Intronic
1077607848 11:3624328-3624350 ACAGGGTGGAGCAGTGGACTTGG - Intergenic
1077763366 11:5129125-5129147 AATGAATGGAGCAGAGTGCCGGG - Intergenic
1077818687 11:5714043-5714065 GCTGAGTGGAGCAGTGGCCCAGG - Intronic
1078830811 11:14974541-14974563 ACTGAGTGGGGCGTAGTGCTTGG + Intronic
1080693390 11:34579268-34579290 AAGGACTGGAGCACAGGGCTAGG - Intergenic
1081582811 11:44364186-44364208 ATTGAGTGGGGAAGAGGGGTTGG - Intergenic
1082811770 11:57482837-57482859 GCGGAGTGGAACAGATGGCTGGG - Intergenic
1083289391 11:61681225-61681247 ACTGAGGAGGGCAGAAGGCTGGG + Intronic
1083990769 11:66244465-66244487 GCTGGGGGGTGCAGAGGGCTGGG - Exonic
1084311959 11:68322235-68322257 TCTGAGTGGAGGAGAGGGCAGGG - Intronic
1084872269 11:72106221-72106243 ACTTCTTGGAGCAGAAGGCTAGG - Intronic
1085310655 11:75514644-75514666 AGTGAGTGAAGCAGAGAACTGGG - Intronic
1086857536 11:91883407-91883429 AGTGAGTGGTGCAGAGATCTTGG - Intergenic
1087842937 11:102938712-102938734 TGTGAGCTGAGCAGAGGGCTGGG - Intergenic
1088727984 11:112656355-112656377 TGTGAGGGGAGGAGAGGGCTTGG - Intergenic
1089628003 11:119763600-119763622 TCTCAGTGGAGCAGAAGCCTGGG - Intergenic
1089682005 11:120123869-120123891 ACTCTGTGGGGCACAGGGCTGGG - Intronic
1090258574 11:125302915-125302937 ACTGTGTGGAGCAGCGAGCTAGG - Intronic
1090346619 11:126076780-126076802 AATGAATGGAACAGAGGGGTGGG - Intergenic
1091061155 11:132463577-132463599 ATTGAGAGGAGCTGAGGGTTAGG + Intronic
1091145165 11:133273216-133273238 CCTGAGTGAACCAGAGGGATGGG + Intronic
1092097952 12:5859870-5859892 ACTTAGTGGAGGACAGGTCTGGG - Intronic
1092313346 12:7382904-7382926 ACTGTGTGGAATAGATGGCTGGG - Intronic
1092405612 12:8220090-8220112 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1092522971 12:9292420-9292442 ACTGCCTGGAGCAGAAGGCATGG + Intergenic
1092544320 12:9439477-9439499 ACTGCCTGGAGCAGAAGGCATGG - Intergenic
1094397008 12:30018144-30018166 ATTGAGTCAAGCAGAGGGCCAGG + Intergenic
1094508627 12:31082590-31082612 ACTGCCTGGAGCAGAAGGCATGG + Intronic
1095212443 12:39509874-39509896 ACTGTGTGGGGGAGAGTGCTGGG - Intergenic
1095289043 12:40454543-40454565 TCTCAGTGGGGCAGTGGGCTAGG + Intronic
1096100650 12:48968976-48968998 ACTGAGAGGAGGAGAGAGGTTGG + Intronic
1096772932 12:53947894-53947916 ACTAAGTGGACAAGAGGCCTGGG + Intergenic
1098147292 12:67510771-67510793 ACTAATTGGAGCACATGGCTAGG - Intergenic
1099236486 12:80088529-80088551 ACTGAGAGGAGGAGAAAGCTGGG - Intergenic
1099525399 12:83712416-83712438 TCTGAGCTGAGCAGAGGGGTGGG - Intergenic
1100594480 12:96060275-96060297 ACTGAGTGGAGATGAGTTCTGGG + Intergenic
1100863735 12:98833651-98833673 ACTGAGTGATGCTGAGGTCTGGG + Intronic
1101917889 12:108910366-108910388 ACCCAGTGGAGCTGGGGGCTGGG - Intergenic
1102742725 12:115222574-115222596 ACTGTGTGGGGCACAGGGCTAGG + Intergenic
1103041412 12:117698558-117698580 GCTGAGTTGAGCAGATGGCTTGG - Intronic
1103549877 12:121729088-121729110 ACTGAGTGTGGCAGAGGGATGGG + Intronic
1103897673 12:124284561-124284583 ACTGTGTGGAGCAGAACCCTCGG - Intronic
1104253887 12:127123510-127123532 CTTGAGTGGAGCAGAGGGTGGGG + Intergenic
1104801396 12:131557183-131557205 AGTCAGGGGAGCAGAGGCCTGGG + Intergenic
1104958403 12:132476919-132476941 ACTGAGGGCAGCTCAGGGCTGGG - Intergenic
1105701996 13:22940756-22940778 ACTGTGTGGAGCACAGGCCCTGG + Intergenic
1105854618 13:24362562-24362584 ACTGTGTGGAGCACAGGCCCTGG + Intergenic
1106021096 13:25916252-25916274 GCTGAGTGGCGCAGAGGGCCTGG - Intronic
1106257256 13:28032724-28032746 ACTGAGAAGGGCAGAGGGGTGGG + Intronic
1108213588 13:48161816-48161838 ACCTAGAGGAGAAGAGGGCTTGG - Intergenic
1108442478 13:50469417-50469439 GGTGAGAGGAGCAGAGGGCTTGG - Intronic
1108763054 13:53593405-53593427 ACTGAGTGGTGAAGCCGGCTGGG + Intergenic
1111813568 13:93121846-93121868 GCTGAGGGGAGCAGTGGGTTGGG + Intergenic
1111897780 13:94162467-94162489 ACTGAGTGTGTCACAGGGCTGGG - Intronic
1114791019 14:25658425-25658447 TCTGACTGAAACAGAGGGCTGGG - Intergenic
1116455095 14:45111097-45111119 ACTAAGTAGAACAGAGGACTTGG + Intronic
1117024981 14:51609912-51609934 ACTGAGCAGAGCAGAGGAATGGG - Intronic
1118056579 14:62085408-62085430 AGGGAGTAGAGTAGAGGGCTAGG + Intronic
1118277784 14:64401050-64401072 ACAGAGAAGAGCAGAGGGCCAGG - Intronic
1118336277 14:64855926-64855948 ACTGAGAGGCTCACAGGGCTGGG + Intronic
1119592159 14:75899990-75900012 GCTGAGTGGAGCAAAGCCCTGGG - Intronic
1120759648 14:88274055-88274077 GCTGAGTGGAGCCTAGGGCAGGG - Intronic
1121629025 14:95409147-95409169 ATAGAGTGGAGCACTGGGCTCGG + Intronic
1121702945 14:95970049-95970071 ACTCAGTGAAACAGAGGGCCTGG - Intergenic
1122809371 14:104280452-104280474 AGGGAGCGGAGCAGTGGGCTGGG + Intergenic
1123625864 15:22226535-22226557 TCTGAGTGGGGCAGGGGCCTGGG - Intergenic
1126335680 15:47584038-47584060 ACAGACTAGTGCAGAGGGCTGGG - Intronic
1126955381 15:53927814-53927836 ACTGAGAAGAGCAGGGAGCTTGG + Intergenic
1130232650 15:82108673-82108695 CCAGAGGGGAGCAGAGAGCTGGG + Intergenic
1130559421 15:84946744-84946766 ACCTAGTGGCACAGAGGGCTTGG - Intergenic
1131650143 15:94389243-94389265 AATGAGGGGAGCAGAGGTGTAGG + Intronic
1132939618 16:2500347-2500369 GCTGAGTGGGGCGGTGGGCTCGG - Exonic
1133967689 16:10543465-10543487 AGTGAGTGGAGGAGAGGGTACGG + Intronic
1134021378 16:10923725-10923747 AGTGCGGGGAGCACAGGGCTGGG - Intronic
1134032456 16:11003386-11003408 ACTGTGGGGAGCAGAAGTCTGGG - Intronic
1134518147 16:14903676-14903698 ACTGAGAAAAGGAGAGGGCTGGG + Intronic
1134705818 16:16302330-16302352 ACTGAGAAAAGGAGAGGGCTGGG + Intergenic
1134961723 16:18409784-18409806 ACTGAGAAAAGGAGAGGGCTGGG - Intergenic
1134966021 16:18492383-18492405 ACTGAGAAAAGGAGAGGGCTGGG - Intronic
1138091005 16:54174571-54174593 GCTGTGGGCAGCAGAGGGCTTGG + Intergenic
1138449292 16:57083623-57083645 GCTGAGTGGAGCACTGGCCTGGG + Intergenic
1138527313 16:57616506-57616528 ACTGAGTGGGGATGAGGGGTGGG + Intronic
1139596386 16:67960725-67960747 GCTCAGTGTAGCTGAGGGCTGGG - Intronic
1141670054 16:85486953-85486975 ACTGAGGTGGGCACAGGGCTAGG - Intergenic
1143358155 17:6346361-6346383 ACTATGTGGAGGGGAGGGCTTGG + Intergenic
1143727648 17:8860450-8860472 ACTGGGTGGGGAAGGGGGCTGGG - Intronic
1145271965 17:21409594-21409616 ACTGATGGGAGCAGGTGGCTGGG - Intronic
1145310173 17:21697059-21697081 ACTGATGGGAGCAGGTGGCTGGG - Intronic
1146263476 17:31436411-31436433 GCAGAGTGGAGCCGAGGCCTGGG + Intronic
1148002195 17:44396010-44396032 ACTGAGCTGGGCAGAGGGCATGG + Intronic
1148274445 17:46290933-46290955 AATGATTGGTGCATAGGGCTGGG - Intronic
1148776469 17:50098441-50098463 ACTGAGTCCAGCATAGTGCTAGG + Intronic
1151232929 17:72697697-72697719 ACAGAATGGAGCAGAGGTCATGG - Intronic
1151583339 17:74992574-74992596 ACTGAGTGGAGCCAAGTACTAGG - Intronic
1152306983 17:79526839-79526861 ACTGAGTGTATGAGAGGGTTTGG + Intergenic
1153339731 18:3961495-3961517 AATGGGTGGGGCAGAGGGCCAGG - Intronic
1154346925 18:13550448-13550470 ACTGGGAGCTGCAGAGGGCTCGG + Intronic
1155364400 18:25035894-25035916 ATTGAGCTGAGCTGAGGGCTCGG + Intergenic
1156399556 18:36728199-36728221 GCTGAGTGGGGAAGAGGGCATGG + Intronic
1157389954 18:47293361-47293383 GCTGAGTGGACCAGTGGGCATGG - Intergenic
1158290639 18:55937760-55937782 TGTGTGTGGAGCAGAGGGGTTGG + Intergenic
1160760109 19:779605-779627 ACGGAGAGGAGCAGAGAGCAAGG + Intergenic
1161516561 19:4699821-4699843 ACTCCGTGGGGCAGATGGCTGGG - Intronic
1162144841 19:8607340-8607362 ACAGGGTGGAGGAGAGGCCTGGG - Intronic
1162440024 19:10687148-10687170 GGTGAGTGGAGCTGAAGGCTGGG + Intronic
1163174116 19:15552245-15552267 ACTGAGCGAAGCTGCGGGCTAGG + Exonic
1167166775 19:47804016-47804038 GTTGAGTGGAGCAGAGGACTGGG - Intronic
1167175061 19:47859748-47859770 GTTGAGTGGAGCAGAGGACTGGG + Intergenic
1167536161 19:50053142-50053164 ACTGAGTGGGAGAGAGGGATAGG + Intronic
1167606009 19:50481518-50481540 ACTCAATGGACCAGAGGCCTGGG - Intronic
1167694062 19:51003631-51003653 ATTTAGGGGAGCAGAGGGGTCGG - Intronic
1168315494 19:55483172-55483194 AGCCAGTGGAGCAGGGGGCTGGG - Exonic
1168724619 19:58573953-58573975 GCTGAGTGGATCAGAGGGTCAGG + Intergenic
924983755 2:248608-248630 TCTGAGAGGAGCCCAGGGCTTGG + Intronic
925188853 2:1867184-1867206 ACTGAGTGGAGAAAAGGGTGTGG + Intronic
925930870 2:8706798-8706820 ACTGATGGGTGCAGAGGGATGGG - Intergenic
926224902 2:10960818-10960840 CCTGCGTGGAGCAGAGGGGAGGG + Intergenic
927432249 2:23036611-23036633 TCTGGGTGTAGCAGAGAGCTTGG - Intergenic
927579132 2:24225610-24225632 ACTGGGGGGAGCAGAGAGCCAGG - Intronic
928239738 2:29576171-29576193 AATGAATGAAGCAGAGAGCTAGG + Intronic
928452077 2:31386288-31386310 AGTCAGTGGGGCAGAGGGATAGG + Intronic
928786936 2:34899298-34899320 TTTGAGTGGTGCAGAGGCCTGGG - Intergenic
928880008 2:36087372-36087394 AGTGAGAAGAGCAGAAGGCTTGG - Intergenic
929610898 2:43269982-43270004 ACTGCCTTGAGAAGAGGGCTTGG - Intronic
930002050 2:46868137-46868159 ACTGAGAGAAGCGCAGGGCTGGG + Intergenic
930100023 2:47596281-47596303 ACTGAGTGGAGAGGGGGGCTGGG + Intergenic
930186681 2:48418616-48418638 TGTGACTGGAGCAGAGGGCAAGG - Intergenic
931123974 2:59253281-59253303 ACTGTGTGGAGCAGTGGTCTTGG + Intergenic
931518881 2:63073521-63073543 ACTGAGTGATGCTGAGGTCTGGG - Intergenic
932356239 2:71070598-71070620 ACTGAGGGGATCAGAGGGCTTGG + Intronic
932573007 2:72947774-72947796 ACGGAGTGGCGAAGAGGCCTGGG - Intronic
932882128 2:75512543-75512565 AATAACTGGAGCAGAGGTCTTGG + Intronic
932979142 2:76642367-76642389 ACTGAGGGAAGAAGGGGGCTGGG - Intergenic
933005447 2:76987691-76987713 ACTGTGTGGAGCAAAGCCCTAGG - Intronic
933942246 2:87254364-87254386 GCTGGGTAAAGCAGAGGGCTGGG - Intergenic
934529776 2:95077548-95077570 ACTGAGTGGAGGAGTGTGCTTGG - Intergenic
935341765 2:102065266-102065288 AATGTGTGGTGCAGAGGGCCTGG + Intronic
935977706 2:108595386-108595408 TCTGGGTGGAGCTGAGGTCTGGG - Intronic
936337979 2:111607205-111607227 GCTGGGTAAAGCAGAGGGCTGGG + Intergenic
936993387 2:118389120-118389142 ACTGAGAGCTGCAGAGGGCAAGG - Intergenic
936994891 2:118403057-118403079 ACGCAGTGGAGGAGATGGCTGGG - Intergenic
937418888 2:121738540-121738562 ACTGAGTGGAGAGGAAGGGTGGG + Intronic
937917938 2:127108130-127108152 ATTGAGTTGAGCAGAGAGATAGG + Intergenic
937959948 2:127449968-127449990 ACTTACGGGAGCAGAGGCCTAGG - Intronic
938016702 2:127873254-127873276 ACTGAGACCAGTAGAGGGCTTGG + Intronic
938195096 2:129319789-129319811 ACTGAGTGGAGGAGAAGGCAGGG - Intergenic
938305090 2:130247830-130247852 ACAGATTGGAGAGGAGGGCTGGG + Intergenic
938408040 2:131043628-131043650 AGGGAGGGGAGCTGAGGGCTGGG + Intronic
938448924 2:131399377-131399399 ACAGATTGGAGAGGAGGGCTGGG - Intergenic
940918741 2:159285959-159285981 GCTGAGTGCGGCAGAGGGCTGGG - Intronic
942749991 2:179276572-179276594 ACTGGGTGGGGCAGAGGGTTGGG + Intergenic
946201655 2:218074021-218074043 AGTGTGTGGAGCAGGGGACTGGG + Intronic
946404507 2:219485135-219485157 TGTGGGAGGAGCAGAGGGCTGGG + Intronic
948359764 2:237412006-237412028 ACTGAGTGGAGCAGAGGGCTTGG - Intronic
948718680 2:239882559-239882581 ACTGCAGGGAGCTGAGGGCTGGG + Intergenic
948764668 2:240213249-240213271 GCTTATGGGAGCAGAGGGCTCGG - Intergenic
1168829930 20:840328-840350 CCTGAGTGTGGCAGAGGGCTGGG + Intronic
1170693400 20:18635557-18635579 ACTGTGCAGAGCAGTGGGCTGGG - Intronic
1170830253 20:19833655-19833677 AGTGAGTGTAGCAGTGCGCTTGG + Intergenic
1171036104 20:21714128-21714150 AGTGAAGGGCGCAGAGGGCTGGG - Intronic
1171317138 20:24205288-24205310 AAAGAGAGGAGCAGAGGGCAGGG + Intergenic
1171325218 20:24285149-24285171 AGAGAGTGGAGCTGAGGGCTGGG - Intergenic
1171382973 20:24747095-24747117 ACTGACTGGAAAAGAGGCCTTGG - Intergenic
1172173900 20:32960918-32960940 ACTGGGTGGAGAGCAGGGCTGGG + Intronic
1173136849 20:40446420-40446442 ACTGCCTGGAGCAGAAGACTGGG + Intergenic
1173459613 20:43232697-43232719 AGTGAGTGGTGCAGAGGAATGGG + Intergenic
1174252598 20:49230775-49230797 ACAGAGAGGAACAGAGAGCTGGG - Intronic
1174455725 20:50647417-50647439 ACAGAGGTGAGCAGAGGCCTTGG + Intronic
1174543667 20:51308830-51308852 ACTGAGCGGGGCTGAGTGCTGGG + Intergenic
1175400245 20:58696159-58696181 ACTGAGGGCAGCAGAGGTCAGGG - Intronic
1175999839 20:62826869-62826891 TCTGAGAGGAGCAGAGGGAAAGG - Intronic
1176204126 20:63878945-63878967 CCTCAGTGGACCAGAAGGCTGGG - Intronic
1179054357 21:37917011-37917033 ACTGAATGGGGCAGCAGGCTGGG - Intergenic
1180016976 21:45093466-45093488 GCTGTGTGGCCCAGAGGGCTCGG - Intronic
1180194361 21:46184045-46184067 ACTGGGTGGCCCTGAGGGCTGGG + Intronic
1180765859 22:18345592-18345614 TCTCACTGGAGCAGGGGGCTTGG - Intergenic
1180780454 22:18516786-18516808 TCTCACTGGAGCAGGGGGCTTGG + Intronic
1180813170 22:18774107-18774129 TCTCACTGGAGCAGGGGGCTTGG + Intergenic
1181199347 22:21208423-21208445 TCTCACTGGAGCAGGGGGCTTGG + Intronic
1181400413 22:22647434-22647456 TCTCACTGGAGCAGGGGGCTTGG - Intronic
1181702393 22:24628532-24628554 TCTCACTGGAGCAGGGGGCTTGG - Intronic
1181856065 22:25782416-25782438 GCTGAGTGGAGCAGTGAGCTGGG + Intronic
1181894332 22:26093595-26093617 TCCGCCTGGAGCAGAGGGCTGGG + Intergenic
1182444834 22:30384027-30384049 AGTGAGTGATGCAGAGAGCTGGG + Intronic
1182573010 22:31253054-31253076 ACTGAGGGGTTCTGAGGGCTTGG - Intronic
1184089769 22:42286250-42286272 ACTGTGTGGATCAGAGGACAAGG - Intronic
1184940055 22:47757575-47757597 GGGGAGTGGAGCAGAGTGCTGGG - Intergenic
1185360227 22:50402292-50402314 GCTGAGTTGGGAAGAGGGCTGGG + Intronic
1203227478 22_KI270731v1_random:86483-86505 TCTCACTGGAGCAGGGGGCTTGG - Intergenic
949868059 3:8562965-8562987 ACTAAGTGCAGCAGAGAGCTGGG - Intronic
950308474 3:11935246-11935268 ACTGAGTGGTGAAGGGGGATGGG - Intergenic
950426037 3:12925186-12925208 ACTGAGGGGAGCAGGGAGTTGGG - Intronic
950675197 3:14550371-14550393 ACTGAGAGGTGCCGAGGGCTTGG - Intergenic
951700045 3:25487146-25487168 ACTGAGGGTAGCACAGGGCCAGG - Intronic
952381801 3:32811116-32811138 AATGAGTGAAGGAGAGGACTAGG + Intergenic
952902856 3:38121291-38121313 GCTGAGAGGAGCTGAGGGCTGGG + Intronic
953840296 3:46384714-46384736 ACTGAGTGGAGCATAGGAGTAGG + Intergenic
954800426 3:53183911-53183933 TCTAAGTGAAGCAGAGGGCAGGG - Intronic
955605414 3:60696638-60696660 AGTCTGTGGATCAGAGGGCTGGG + Intronic
960952287 3:123007180-123007202 ACTGAGTGGGGCAGAAGGAAGGG - Intronic
960998719 3:123357918-123357940 ACTGAGTGGAGAAGAGAGCCTGG - Intronic
961372309 3:126439061-126439083 ACTGGTGGGAGCAGAGGGCCGGG - Intronic
961921737 3:130433561-130433583 CCTGAGTGGAGAAGAGTGCAAGG - Intronic
962057564 3:131888038-131888060 GCTGAGAGGACCAGAAGGCTGGG - Intronic
962710012 3:138078288-138078310 ACTGAGTGAGTCAAAGGGCTTGG - Intronic
963041697 3:141074987-141075009 GCTGACTGGACCAGAGAGCTGGG + Intronic
963610732 3:147464695-147464717 ACTGAGTGTAACTGATGGCTTGG + Intronic
966856403 3:184196794-184196816 ACAGACTGGAGCAGAGGGAGAGG + Intronic
967372930 3:188769364-188769386 ACTAAGATGAGCAGAGGGCTGGG - Intronic
967472160 3:189874443-189874465 ACAGAGTGGAGTAGACGGCAGGG + Intronic
967686766 3:192426326-192426348 ACTTAGCACAGCAGAGGGCTAGG + Intronic
967740066 3:192995061-192995083 ACAGAGGGGAACAGAGGGATGGG - Intergenic
968137374 3:196228787-196228809 CCTGAGTGGGGAAGAGGGTTAGG - Exonic
968348527 3:198032364-198032386 ACTAAGTACAGCAGAGAGCTGGG - Intronic
968866701 4:3217507-3217529 AGAGAGTGGGCCAGAGGGCTGGG + Intronic
969220766 4:5757000-5757022 ACTGGGAGGAGGAGAGGGCCTGG + Intronic
969325498 4:6441655-6441677 CATGAGAGGAGCAGAGGCCTCGG - Intronic
969410084 4:7022270-7022292 CCTGACTGGGGCAGAGGGCCTGG + Intronic
969454034 4:7291058-7291080 GCTAAGTGGAGCACAGGGCATGG + Intronic
969626348 4:8307670-8307692 TCTGGGTGGAGCAGAGGGTTGGG - Intergenic
969760500 4:9177881-9177903 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
970556681 4:17240829-17240851 ACTGAGGGGAGCATATGGCTTGG + Intergenic
971230744 4:24799018-24799040 ACTGAGTGTAGCAGAGAACAGGG + Intronic
972787997 4:42345471-42345493 ACTGTGTGGGGCAGAGGACAGGG - Intergenic
975420814 4:74162139-74162161 ATTAAGTGGAGCAGCTGGCTAGG - Intronic
976094420 4:81492432-81492454 TCAGAGTTGAGCAGATGGCTTGG + Intronic
978120726 4:105076036-105076058 CCTGATTGGAGAAGATGGCTTGG - Intergenic
978572577 4:110154727-110154749 ACTGAGTTGAGAAGATGGCTTGG + Intronic
980836063 4:138194085-138194107 GCTGAATGGAGCAGAGGGAAAGG + Intronic
981902811 4:149886814-149886836 ACTAAATGCTGCAGAGGGCTAGG - Intergenic
982637322 4:157913564-157913586 ACTGTGTAGGGAAGAGGGCTAGG - Intergenic
983647305 4:170004809-170004831 ACTGTGTGAAGTAGAGGGGTTGG - Intronic
984702604 4:182827815-182827837 CCTCAGAGGAGCAGAGGGGTTGG + Intergenic
985612294 5:897129-897151 ACTGAATGAAGCCGTGGGCTTGG - Intronic
985962419 5:3312560-3312582 AATGAGTGGTCAAGAGGGCTAGG - Intergenic
986281068 5:6322989-6323011 AATGGGTGGAGCAGAGAGATTGG + Intergenic
986383776 5:7210999-7211021 ATTAAGAGGAGCAGAGGGCTTGG - Intergenic
989212123 5:38866525-38866547 ACTGAGTGAGGTAGAGTGCTGGG + Intronic
990950300 5:61292094-61292116 ATTAAGTGGAGCAAAAGGCTTGG + Intergenic
994613077 5:102070481-102070503 ACTGAGTGATGCTGAGGCCTGGG - Intergenic
998351087 5:141501896-141501918 GCTGAGTGGAACAGTGGGGTTGG - Intronic
999382070 5:151128271-151128293 TCTGAGAGGAGCCCAGGGCTGGG - Intronic
999826806 5:155281384-155281406 AGTGGGTGGCTCAGAGGGCTGGG + Intergenic
1001773109 5:174310422-174310444 ACCGAGTGGAGCAGAGAGCCAGG - Intergenic
1002296426 5:178233577-178233599 AGGGAGTGAAGCAGAGGCCTGGG - Intergenic
1002368842 5:178733700-178733722 ACTGAGTAGGGCAGGGGGTTAGG - Intergenic
1002399444 5:178983369-178983391 ACTCAGTGGAGAAGAGGGGATGG + Intronic
1002655100 5:180739725-180739747 ACTCTGTGGAGCCCAGGGCTAGG + Exonic
1003534230 6:6962176-6962198 ACTTGGTGGAGAAGAGGGCCTGG + Intergenic
1004084536 6:12432246-12432268 ACTCAGAGGAGCACAGTGCTGGG + Intergenic
1011239695 6:85257874-85257896 ACTCACTGGAGCAAAGGGCATGG - Intergenic
1011441167 6:87388773-87388795 TCTGAGTGGATCAGATGTCTGGG + Intronic
1011544939 6:88472927-88472949 GCTGAGAGGAGCAGAGGGAGAGG - Intergenic
1012029875 6:94045516-94045538 ACTGAATGGAACAGGGGGGTTGG - Intergenic
1013066365 6:106687930-106687952 GCTGAGTTGAGCAAAGAGCTAGG + Intergenic
1013298339 6:108780293-108780315 GATGAGAGGAGCCGAGGGCTGGG + Intergenic
1016095696 6:140033723-140033745 ACTGAGCAGAGCAGAGGGTAGGG + Intergenic
1016230859 6:141802132-141802154 AGTGAGTGGAGCACAGGATTTGG + Intergenic
1017096945 6:150812960-150812982 AGTGAGTGAAGCAGAGAGCAGGG + Intronic
1018118898 6:160616263-160616285 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018119502 6:160621809-160621831 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018120102 6:160627353-160627375 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018120706 6:160632899-160632921 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018121300 6:160638446-160638468 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018121902 6:160643993-160644015 GCTGAATGGAGGAGAGGGATTGG - Intronic
1018630033 6:165814347-165814369 CCTGTGTGGAGCAAGGGGCTGGG - Intronic
1019060175 6:169251839-169251861 ACTGGGGGGAGCAGATGGTTTGG - Intronic
1019118972 6:169788211-169788233 ACTGAGTGGAGCAGAGGATAAGG - Intergenic
1019173269 6:170146771-170146793 GCTGCTTGGAGCAGAGGCCTGGG - Intergenic
1019275091 7:172054-172076 ACTGCGGAGAGTAGAGGGCTGGG + Intergenic
1019323092 7:424503-424525 CCTCAGTGGGGCAGAGGCCTTGG - Intergenic
1020194479 7:6026458-6026480 ACAAAGAGGAGCGGAGGGCTGGG - Intronic
1021560654 7:21965831-21965853 ACTGAGGGGAGGTGGGGGCTGGG - Intergenic
1022471376 7:30683511-30683533 GCTGAGTGGGGCATTGGGCTCGG + Intronic
1023150145 7:37194396-37194418 AAGGTGTGGAGCACAGGGCTTGG - Intronic
1023755112 7:43408777-43408799 ACTGAGGGGAGGGGAGGCCTAGG + Intronic
1023833885 7:44057336-44057358 GCTGTGTGGAGCTGATGGCTGGG + Intronic
1024227447 7:47336917-47336939 GCCTAGTGGAGAAGAGGGCTTGG - Intronic
1026085245 7:67257961-67257983 ACTCAGTAAATCAGAGGGCTTGG + Intergenic
1026599931 7:71769476-71769498 ACTGAGTGGAGCAATGTTCTTGG + Intergenic
1026691926 7:72556933-72556955 ACTCAGTAAATCAGAGGGCTTGG - Intergenic
1026974641 7:74489905-74489927 AGGGAGTGGGGCAGAGGACTTGG + Intronic
1027230152 7:76267724-76267746 ACTGAGTTGGGTACAGGGCTGGG + Intronic
1029101428 7:98133721-98133743 AGTAAGTGTAGCAGAGAGCTAGG + Intronic
1033332686 7:140429319-140429341 TAAGAGTGGAGCAGGGGGCTGGG - Intergenic
1034158643 7:148976166-148976188 ACAGACTGGAGCAGAGAGCAGGG + Intergenic
1036262839 8:7254004-7254026 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036264144 8:7261627-7261649 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036265439 8:7269249-7269271 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036266741 8:7276871-7276893 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036268047 8:7284493-7284515 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036269351 8:7292115-7292137 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036297242 8:7547309-7547331 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036298544 8:7554964-7554986 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036299849 8:7562614-7562636 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036301156 8:7570260-7570282 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036302458 8:7577909-7577931 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036303750 8:7585554-7585576 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036314879 8:7712544-7712566 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036316184 8:7720166-7720188 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036317495 8:7727814-7727836 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036318803 8:7735462-7735484 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036320110 8:7743109-7743131 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036321419 8:7750757-7750779 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036322728 8:7758405-7758427 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036324029 8:7766054-7766076 ACTGAGGGGACCGCAGGGCTGGG + Intergenic
1036352012 8:8018253-8018275 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036353312 8:8025899-8025921 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036354604 8:8033546-8033568 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036846010 8:12171037-12171059 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1036867375 8:12413356-12413378 ACTGAGGGGACCGCAGGGCTGGG - Intergenic
1037357624 8:18039234-18039256 ACTGTGTGGTGCTGAGGTCTGGG - Intergenic
1037384814 8:18327007-18327029 AATGAGGAGAGCAGAGTGCTGGG - Intergenic
1037401522 8:18499330-18499352 ACTAACTGGAGCAGAGGGGCTGG + Intergenic
1037745885 8:21643677-21643699 TCTCACTGGAGCTGAGGGCTTGG - Intergenic
1037902256 8:22694978-22695000 ACTGAGTGGAGGGGAGGGGAGGG - Intergenic
1038399506 8:27272191-27272213 ACTGAAAGGAGCAGTGGGGTGGG - Intergenic
1039419297 8:37422096-37422118 CCTCAGTGGAGCAGAGTGCCTGG + Intergenic
1039476814 8:37843115-37843137 ACTGAGGGGAGTAGAGGGAGAGG + Exonic
1039584777 8:38697247-38697269 AATGAGTTGTCCAGAGGGCTGGG - Intergenic
1042027639 8:64440921-64440943 ACTGGGTGGAGCTAAGGGCAGGG - Intergenic
1042228187 8:66531264-66531286 AGTGGGTGGAGTAGGGGGCTGGG + Intergenic
1043456152 8:80414353-80414375 GCTGAGAGGAGGAGGGGGCTGGG + Intergenic
1044839739 8:96327564-96327586 TCTGAGTGGGGCAGAAGGCATGG - Intronic
1045128907 8:99126046-99126068 CTTGAGTGGATAAGAGGGCTTGG + Intronic
1046116711 8:109793276-109793298 ACTGGGAGGAGCAGAGAGGTTGG + Intergenic
1046526161 8:115384635-115384657 ACTGATTGGAGTAGAGTGCTGGG - Intergenic
1046909974 8:119615226-119615248 ACTGGTTAGAGAAGAGGGCTGGG - Intronic
1048006255 8:130421633-130421655 ACAGAATGTAGCAGAGGCCTAGG + Intronic
1048979097 8:139693613-139693635 ACTGAGTAGCACAGTGGGCTGGG + Intronic
1049036603 8:140081181-140081203 ACTGTGAGGAGCAGAGGTCCAGG - Intronic
1049364803 8:142232001-142232023 CCTGAGGGGAGCAAAGGGCATGG + Intronic
1049583752 8:143423758-143423780 ACGGAGTCCAGCCGAGGGCTGGG - Intronic
1049740553 8:144239014-144239036 ACCTAGGGGAGCAGAGGGCCTGG - Exonic
1051439285 9:17066839-17066861 CCTGAGTCAAGCAGAGAGCTAGG - Intergenic
1052399616 9:27984064-27984086 ACTGTGTGGGGCAGTGGACTGGG + Intronic
1054834064 9:69658053-69658075 GTGGTGTGGAGCAGAGGGCTGGG - Intronic
1057181229 9:93031757-93031779 ACTGAATGTTGCAGAGGACTTGG - Intronic
1057249619 9:93489985-93490007 ACACAGTGGAGCACAGGTCTGGG - Intronic
1057745635 9:97748733-97748755 ACAAAGTGGAGCAGAAGGCAGGG + Intergenic
1058736636 9:107899921-107899943 AATGAGAGGAGAAGATGGCTGGG - Intergenic
1060222927 9:121773952-121773974 ACTGAGTGGGGGACAGGGCCAGG - Intronic
1060422512 9:123479573-123479595 ACAGAGGGGAGCAGAGGGCTGGG - Intronic
1061014684 9:127974948-127974970 GCTGAGTGGAGCAGGGGCCGTGG - Intronic
1061374807 9:130217520-130217542 CTTGGGTGGAGCACAGGGCTGGG + Intronic
1061387087 9:130296730-130296752 GCTGAGTGGAGAAGCCGGCTCGG - Intronic
1062686370 9:137815511-137815533 AGAAAGGGGAGCAGAGGGCTGGG + Intronic
1185458118 X:320383-320405 TCTGAGTGGGGCAGGGGCCTGGG + Intergenic
1185703732 X:2250932-2250954 ACAGAGTGGATCACAGAGCTTGG + Intronic
1199928769 X:152496505-152496527 ACTGAGTGGAGCCTAAGACTGGG - Intergenic
1200078575 X:153564432-153564454 GCTCAGTGGGGCAGGGGGCTGGG - Intronic