ID: 948359765

View in Genome Browser
Species Human (GRCh38)
Location 2:237412011-237412033
Sequence CAGACACTGAGTGGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359765_948359770 7 Left 948359765 2:237412011-237412033 CCCTCTGCTCCACTCAGTGTCTG 0: 1
1: 0
2: 1
3: 38
4: 309
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359765_948359773 30 Left 948359765 2:237412011-237412033 CCCTCTGCTCCACTCAGTGTCTG 0: 1
1: 0
2: 1
3: 38
4: 309
Right 948359773 2:237412064-237412086 AAAGGAGAGAACTAAACCTCTGG 0: 1
1: 0
2: 5
3: 27
4: 285
948359765_948359771 12 Left 948359765 2:237412011-237412033 CCCTCTGCTCCACTCAGTGTCTG 0: 1
1: 0
2: 1
3: 38
4: 309
Right 948359771 2:237412046-237412068 TCTCGACCATGAGTGAGGAAAGG 0: 1
1: 1
2: 0
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359765 Original CRISPR CAGACACTGAGTGGAGCAGA GGG (reversed) Intronic
900363911 1:2302845-2302867 ACGACCCTGAGTGGCGCAGAAGG - Intronic
902182786 1:14702125-14702147 GAGGCAATGAGTGGGGCAGAGGG + Intronic
902525359 1:17053883-17053905 CAGAGACTGCCTGGAGCTGATGG - Intronic
902530920 1:17090218-17090240 CAGGCACTGAGTGCAGTAGCTGG - Intronic
904211491 1:28888996-28889018 CAGAAGCTGAAGGGAGCAGAGGG + Intronic
904388494 1:30163326-30163348 CAGACACGTGGTGGAGCAGGTGG + Intergenic
904607990 1:31709097-31709119 CAGAAACAGAGACGAGCAGATGG - Intergenic
906149360 1:43578514-43578536 CAGAAACTGAATGGAGCTGGGGG + Intronic
906784329 1:48601070-48601092 CAGTCACTGAAGGGAGCAGGAGG - Intronic
908484187 1:64573993-64574015 CAGAAAGTGAGTGGAACAAATGG + Intronic
912175802 1:107154619-107154641 AAAAAACTGGGTGGAGCAGATGG + Intronic
912272346 1:108224094-108224116 AAGAAACAGAGGGGAGCAGAAGG + Intronic
912295875 1:108470227-108470249 AAGAAACAGAGGGGAGCAGAAGG - Intronic
912735206 1:112144242-112144264 CAGACAGTGTGTGCAGCAGATGG - Intergenic
913514056 1:119587722-119587744 CTGACTCTGAGTGGTGAAGACGG + Intergenic
913543799 1:119846978-119847000 GAGACAATGAGTGGCGCTGATGG - Intergenic
913991206 1:143613929-143613951 TAGACAATGAGTGGCGCTGATGG - Intergenic
914212524 1:145593448-145593470 GAGACAATGAGTGGAGCTGATGG - Intergenic
915552930 1:156645604-156645626 CTGGCACTGGGAGGAGCAGATGG + Intronic
915764974 1:158353763-158353785 CAGACAGTGAGAGAGGCAGAGGG + Exonic
916933897 1:169607859-169607881 CAGACACTGAGTTCAGGAGTGGG + Intronic
916987980 1:170212133-170212155 CAGATAATGAATGGAGCAGTGGG + Intergenic
917216365 1:172682276-172682298 CAACCCATGAGTGGAGCAGATGG - Intergenic
920145834 1:203860506-203860528 CAGCTACTAAGTGGAGCAGCTGG - Intergenic
920534815 1:206730624-206730646 GAGAAACTGAGTGGATCACAGGG + Intronic
920943815 1:210509684-210509706 CACACACAGAGTGGAGAAGGGGG - Intronic
923761290 1:236847370-236847392 CAGACACTGTGAGGAAGAGAAGG - Intronic
1063213889 10:3906613-3906635 CAGGCCCTGCGTGCAGCAGATGG + Intergenic
1063409947 10:5829892-5829914 CAGTAACTGATAGGAGCAGATGG + Intronic
1063424175 10:5938520-5938542 TAGACAATGAGAAGAGCAGAGGG + Intronic
1065971871 10:30812117-30812139 TGGAGACTGAATGGAGCAGACGG - Intergenic
1065986529 10:30959229-30959251 TAGACTTTGAGTAGAGCAGATGG + Intronic
1066622677 10:37374763-37374785 CAGACAGTGAATGGCGCAGTGGG - Intronic
1067020328 10:42791236-42791258 CAGACACTGCCTGGTGCAGCAGG - Intronic
1067495286 10:46756077-46756099 GAGTCGCTGAGTGGAGGAGATGG + Intergenic
1067599368 10:47584311-47584333 GAGTCGCTGAGTGGAGGAGACGG - Intergenic
1067658514 10:48215936-48215958 CATAGACTGAGTAAAGCAGATGG + Intronic
1067776835 10:49170386-49170408 CAGCCACAGAGAGGGGCAGAAGG - Intronic
1067949028 10:50710897-50710919 GAGTCGCTGAGTGGAGGAGACGG - Intergenic
1068189028 10:53625903-53625925 CTGCCACTGACTGAAGCAGAAGG + Intergenic
1069220359 10:65875845-65875867 CAGGCACTGAGTGGTGCACTAGG - Intergenic
1069346576 10:67477076-67477098 CAGAGACTGTGTGGTGCAGCAGG + Intronic
1069780787 10:70954122-70954144 CAGACACTGTGAGGGGCCGATGG - Intergenic
1070138945 10:73721873-73721895 CAGACACTGCCTGGTGCAGCAGG + Intergenic
1070952819 10:80444523-80444545 AAGACACAGAGTGGCACAGAGGG + Intergenic
1071336040 10:84601248-84601270 CAGCCACTGCCTGGAGCAGTGGG + Intergenic
1071606750 10:86999058-86999080 CAGACACTGCCTGGTGCAGCAGG - Intergenic
1072958153 10:99905180-99905202 CACACATTGAGTTGGGCAGAAGG - Intronic
1073001594 10:100289943-100289965 CACCCACTGAGTGGAAAAGATGG + Intronic
1073430125 10:103480552-103480574 CTGACTCTGAGCGGAGGAGAGGG + Intergenic
1073617477 10:105011138-105011160 CAGGCACAGAGAGGAGCACATGG - Intronic
1076912987 10:133401690-133401712 GGGACACTGAGTGGAGGGGAGGG - Intronic
1077198333 11:1292789-1292811 CAGACACACAGCGCAGCAGACGG + Intronic
1077557051 11:3230874-3230896 GACACCCTGAGTGGGGCAGACGG + Intronic
1079493990 11:21020324-21020346 CAGACACAGCGTTGAGCAGTGGG + Intronic
1080184205 11:29460338-29460360 GAGAGACTGAGAGGGGCAGAGGG + Intergenic
1083289845 11:61683694-61683716 AAGACACTGAGAGGAGGAGTTGG + Intronic
1084388276 11:68858142-68858164 CACAGACTGAGGAGAGCAGAGGG - Intergenic
1085042831 11:73336684-73336706 CAGGCAGTGAGTGGAAGAGACGG - Intronic
1088507643 11:110542027-110542049 AAGGCACTGAGAGCAGCAGATGG + Intergenic
1089659682 11:119977842-119977864 CAGACGCAGACTGGGGCAGAAGG + Intergenic
1091028384 11:132161680-132161702 CGGACACTGGGTGAAACAGAGGG - Intronic
1092313348 12:7382909-7382931 CAGACACTGTGTGGAATAGATGG - Intronic
1095913988 12:47457773-47457795 CAGACAGTGAGTGCAGCCCATGG - Intergenic
1097681073 12:62649516-62649538 CAAACACTGACCAGAGCAGAGGG + Intronic
1097753623 12:63385116-63385138 TAGAAACTGAGTAGAGCTGATGG + Intergenic
1099389809 12:82066482-82066504 CAGAGACTGACTGGATCTGAGGG - Intergenic
1101443684 12:104722091-104722113 CAGGGACTGAGGGGAGCGGATGG - Intronic
1101600124 12:106202145-106202167 GAGACACTAAGTGCAGCAGCTGG - Intergenic
1101631531 12:106499785-106499807 AAGACACAGAGTGGAGTGGAAGG - Intronic
1102936066 12:116898048-116898070 AGGCCACTGAGTGGACCAGAGGG + Intergenic
1103055994 12:117820836-117820858 GAGACAGGGAGTAGAGCAGATGG - Intronic
1103088110 12:118077615-118077637 AAGACACAGAGTGTGGCAGAAGG + Intronic
1106578666 13:30999409-30999431 CAGACACAAAGAGGAACAGATGG + Intergenic
1108275843 13:48808843-48808865 CAGACACTGTGCAGAGCAGAAGG + Intergenic
1109186603 13:59276693-59276715 CAGACACTAAATGAATCAGAAGG - Intergenic
1111302925 13:86368146-86368168 CAGACACAGAGACCAGCAGAGGG - Intergenic
1112399208 13:99061223-99061245 AAGACACTGAGGGGAACAGGAGG + Intronic
1115214455 14:31001020-31001042 CATATACTGAGTGAGGCAGAGGG + Intronic
1115528041 14:34300877-34300899 CAGGCAGTGGGTGGAGAAGAAGG - Intronic
1117013928 14:51499027-51499049 AAGAAACAGAGTTGAGCAGATGG + Intronic
1117767956 14:59102444-59102466 CAGACACTAAGTGAAGCAATAGG + Intergenic
1117960863 14:61160203-61160225 GAGATACTGAGTGGAGGAGGTGG - Intergenic
1118855424 14:69617983-69618005 CAGACACAAAAAGGAGCAGATGG + Intronic
1119222589 14:72921056-72921078 CAGAGCCTGAGTGGGGAAGAAGG + Intergenic
1120694526 14:87630049-87630071 CAATCACTGAGATGAGCAGATGG - Intergenic
1121564580 14:94899207-94899229 CAGACACAAAGATGAGCAGAGGG - Intergenic
1121625592 14:95383506-95383528 CAGACACAGAGAAAAGCAGAGGG + Intergenic
1122895703 14:104755764-104755786 CAGATGCTGATTGGACCAGACGG + Exonic
1124620174 15:31269396-31269418 GTGACGCTGAGTGGAGAAGAGGG + Intergenic
1124848601 15:33314420-33314442 CAGACAGTCGGTGGAGCAGCTGG + Intronic
1125323559 15:38513742-38513764 CAGACTGTGATTTGAGCAGAGGG - Intronic
1125653575 15:41337718-41337740 CAGAAAGTGCCTGGAGCAGAGGG - Intronic
1126522930 15:49617279-49617301 CAGACAATGTGGGGAACAGAAGG + Intronic
1128577629 15:68787126-68787148 CAGAAACTGAGTGGAAAAGCAGG + Intronic
1129263367 15:74381217-74381239 CAGTCAGTGAGTGGAGGAGCAGG - Intergenic
1129772029 15:78208558-78208580 CAGAAACTGAGTGGAGCTGCAGG + Intronic
1130747886 15:86675596-86675618 CAGACACTGAGGGGTGTTGAAGG - Intronic
1131570240 15:93527590-93527612 CATAGACTGAGTAAAGCAGATGG - Intergenic
1131805894 15:96122234-96122256 CATACACTGATTGAAGCACAAGG + Intergenic
1131893699 15:97002886-97002908 AACACAGTGAGGGGAGCAGATGG + Intergenic
1132715098 16:1286210-1286232 GAGAGACCGAGAGGAGCAGAAGG + Intergenic
1134450688 16:14361592-14361614 CAGCCACTGAGCCCAGCAGAGGG + Intergenic
1135838539 16:25851534-25851556 CAGACAGTGTGTGGAGCTGAAGG - Intronic
1136287468 16:29252940-29252962 CAGACACAGGCTGCAGCAGAGGG - Intergenic
1138436574 16:57003974-57003996 CAGGCACTGAGAGAAGCTGACGG + Intronic
1138458844 16:57136107-57136129 AAAACTCTGAGTGGAGGAGAGGG + Intronic
1138729687 16:59181632-59181654 CAGACACTGAATTCAGCATATGG - Intergenic
1138995727 16:62450447-62450469 CAGAGACTCAGGGGAGCATAAGG + Intergenic
1139481584 16:67233857-67233879 CAGGCACTGAATGGGGAAGAGGG + Exonic
1140640385 16:76964996-76965018 CAGACACTGCATGGGGCACAGGG + Intergenic
1141279728 16:82620450-82620472 CAGACACTGTGTGGGGCAGCAGG + Intergenic
1143290279 17:5822991-5823013 CAGACGTTGAGAGGAGCACATGG - Intronic
1143382198 17:6503434-6503456 CAGGCTCTGAGTGGATGAGAGGG + Intronic
1144887604 17:18474155-18474177 CAGACAGGGCATGGAGCAGAGGG + Intergenic
1145144612 17:20470140-20470162 CAGACAGGGCATGGAGCAGAGGG - Intergenic
1145176065 17:20701537-20701559 CAGACAGGGTGTGGAGCAGAGGG - Intergenic
1145211574 17:21017160-21017182 CAGCCACAGAGTTGAGCAGTTGG - Intronic
1145806814 17:27740179-27740201 CAGGCAGGGTGTGGAGCAGAGGG + Intergenic
1147122598 17:38344276-38344298 AGGAGCCTGAGTGGAGCAGAGGG - Intergenic
1148207969 17:45791444-45791466 CAGACAGTGAGAGAAGCAAAAGG + Intronic
1150223386 17:63509613-63509635 CAGAAACTGGGTGGGGCAGGTGG - Intronic
1150997274 17:70333002-70333024 CAGACTTGGAGTGGAGCAGGTGG - Intergenic
1152123853 17:78434844-78434866 CAGCCGCTGAGTAGAGCAGGTGG - Intronic
1154197418 18:12276784-12276806 CAAGCTCTGTGTGGAGCAGATGG - Intronic
1155098527 18:22584511-22584533 CAGGCAGTGGGTAGAGCAGAGGG - Intergenic
1156091965 18:33482393-33482415 CACACACTCAGTTGAGGAGATGG - Intergenic
1156315369 18:35964257-35964279 CAGACAGACAGTGGGGCAGAAGG + Intergenic
1157784198 18:50467460-50467482 GAGACCCTGAGTGGAGAACACGG - Intergenic
1159150614 18:64518609-64518631 CAGTGACTGAGTGCAGCACAGGG + Intergenic
1159255523 18:65939822-65939844 TGGAAACTGAGTGGAGAAGATGG + Intergenic
1160386404 18:78499635-78499657 GAGACAAGGAGTGGTGCAGACGG - Intergenic
1161816729 19:6503768-6503790 CAGACACAGAGAGGAGCACCAGG - Intergenic
1164870061 19:31635606-31635628 CAGTGACTGTGTGGAGCTGATGG + Intergenic
1166233216 19:41438017-41438039 TAGACTCTGAGTGGAGCTGGTGG + Intronic
1166257135 19:41614822-41614844 AGAACACTGAGTGGAGCAGGAGG + Intronic
1166602856 19:44113390-44113412 CAGACACTCAGTGGAGTAGCGGG + Exonic
1166834540 19:45659252-45659274 CAGACCCTGCGGGGAGCAGGCGG - Intergenic
1166989326 19:46681743-46681765 CAGGATCTGAGGGGAGCAGATGG + Exonic
1167169329 19:47820790-47820812 CAGGGACGGAGAGGAGCAGATGG + Intronic
1168514509 19:57000527-57000549 CAGACAGGGAGAGGAGCAGATGG - Intergenic
925188852 2:1867179-1867201 AAGTCACTGAGTGGAGAAAAGGG + Intronic
925370193 2:3339450-3339472 CAGACCCTGAGAGGAGCAGTTGG - Intronic
926127290 2:10279400-10279422 CTGACTGTGAGTGGAGCTGATGG + Intergenic
927940433 2:27099967-27099989 CAGACATTGAGAGGAGAAGCTGG - Exonic
928257850 2:29740372-29740394 CAGACACTGAGACAAACAGAGGG + Intronic
928280354 2:29940885-29940907 CAGGCTCTGTGCGGAGCAGAGGG - Intergenic
929118479 2:38464809-38464831 GGGATACTGAGTGGAGGAGAGGG - Intergenic
929911297 2:46091455-46091477 CAGACAGTGAGGGGAGTAGAGGG + Intronic
930272835 2:49276763-49276785 CAGACCTTGAGTAGAGGAGAAGG + Intergenic
931427219 2:62182241-62182263 AAGAGACTGAGAGAAGCAGAGGG - Intergenic
931441380 2:62293133-62293155 CAGACACTGGCTAGGGCAGAGGG - Intergenic
932417677 2:71583686-71583708 CAGACACCCCGTGGTGCAGAAGG + Intronic
932715949 2:74100904-74100926 TGGACACTGAGTGGAGTAGGGGG - Exonic
932832841 2:75007505-75007527 TACTCACTGAGAGGAGCAGAGGG + Intergenic
932892376 2:75608365-75608387 CAGTCACTGAAGGGAGCAGAGGG - Intergenic
935143864 2:100380357-100380379 CAGTCAATGTGTGGAGCAGAAGG + Intergenic
935187929 2:100751215-100751237 CTGCCACTGAGAGGAGCAGGAGG + Intergenic
935763652 2:106343660-106343682 CAGACCCTGAGTGGAACGGAGGG - Intergenic
936176182 2:110222124-110222146 CCCCCACTGAGTGGAGGAGATGG - Intergenic
937502013 2:122489422-122489444 CAGACAAAGATTGGAGCAGTGGG + Intergenic
937792908 2:125981352-125981374 CAGACACAGAGTGGAGAGGGTGG + Intergenic
938091224 2:128436035-128436057 CACACACAGAGTGGAGCAAGAGG + Intergenic
938695390 2:133830476-133830498 CAGACACTGGGAAGGGCAGAAGG + Intergenic
939057130 2:137379513-137379535 CACAAACTGAGTGCAGCACAGGG + Intronic
946594052 2:221286342-221286364 AAGACACTAAGAGGAGAAGATGG - Intergenic
946849356 2:223890036-223890058 CAGAGGCTGTGTGGAGCATAGGG - Intronic
948359765 2:237412011-237412033 CAGACACTGAGTGGAGCAGAGGG - Intronic
948479612 2:238241186-238241208 CAGACGCTGTGTGGAGGAGCCGG + Intergenic
948723997 2:239920632-239920654 CAGAAACTGTGTGGAGCAGTTGG - Intronic
948942317 2:241202734-241202756 CAGCCACTGTGGGGAGCAGAAGG + Intronic
1168893329 20:1308094-1308116 AAGACACAGACAGGAGCAGAGGG - Exonic
1170237442 20:14122839-14122861 CAGTCACTGTGTGGATGAGAGGG - Intronic
1170604530 20:17865683-17865705 CAGACACTGCATGGAGCCAAGGG + Intergenic
1170894236 20:20399547-20399569 CAGACACAGAGTTGAGCCGGGGG + Intronic
1170972975 20:21133869-21133891 TAGACACTGTGCGGAGCAGAAGG - Intronic
1171132029 20:22662950-22662972 CAGCCACTCACTGGAGCTGAGGG - Intergenic
1171427193 20:25056805-25056827 CAGACACGGTGTTGATCAGAGGG - Intronic
1172115748 20:32572619-32572641 CAGCCTCTGATTGGAGCAGCAGG + Intronic
1174109585 20:48189366-48189388 CAGCCACTTGGGGGAGCAGAGGG - Intergenic
1175093618 20:56524455-56524477 CAGACATTGTGATGAGCAGAGGG - Intronic
1175625052 20:60483097-60483119 CAGACACTGAGTTATGCAAAAGG + Intergenic
1176048560 20:63104889-63104911 CAGACCCTGCTGGGAGCAGATGG + Intergenic
1178082420 21:29078825-29078847 CAGAAACTAAGTGGAGCTGTGGG - Intronic
1178477141 21:32946858-32946880 CAGTCAGTGAATGGAGCAGGAGG - Intergenic
1179407098 21:41135486-41135508 CTGACCTGGAGTGGAGCAGAAGG - Intergenic
1179717412 21:43297005-43297027 CAGACACTCATTGTAGTAGAAGG + Intergenic
1181010352 22:20036724-20036746 AAAACACTGAGTTGAGCGGATGG - Intronic
949816938 3:8068599-8068621 CAGACAGTGAGTGCAGCCCATGG - Intergenic
950020261 3:9782194-9782216 GAGGCACTGAGGGAAGCAGAGGG - Intronic
950980437 3:17298525-17298547 CAGACACTGAGTGGCTCCTATGG + Intronic
953159789 3:40407753-40407775 CAGCCAGTGAGGGGAGAAGAAGG + Intronic
953477689 3:43219691-43219713 CATTCACTCAGAGGAGCAGAGGG - Intergenic
953683581 3:45058804-45058826 CATAGACTGAGTAAAGCAGATGG - Intergenic
953737429 3:45508385-45508407 CAGCCAGTTAGTGGCGCAGAAGG - Intronic
954536990 3:51368221-51368243 CAGACACTGGGTGCAGCCCACGG + Intronic
954563344 3:51577758-51577780 CGGACACTGGGTGGAGCCCACGG - Intronic
956717397 3:72090397-72090419 CAGACACAGACTGGCACAGAAGG - Intergenic
959933123 3:112003779-112003801 AAGACACTGAGTAGGGGAGATGG - Intronic
959966514 3:112361702-112361724 CAAACACTGAGTAGCTCAGATGG - Exonic
959987588 3:112593186-112593208 CAGAGACAGATTGGAGCAGGTGG - Intergenic
960096190 3:113691982-113692004 TGGACAGGGAGTGGAGCAGATGG + Intronic
960952289 3:123007185-123007207 CTAACACTGAGTGGGGCAGAAGG - Intronic
962684675 3:137835871-137835893 CAGACACTGAGTGGTGAAGTTGG - Intergenic
963595269 3:147317622-147317644 CAGACAGTGAGTGCAGCCCATGG - Intergenic
963665960 3:148186538-148186560 CAGACAGTGATGGGAACAGAAGG - Intergenic
963991399 3:151660063-151660085 CAGACACTGAGTGGGCAAAATGG + Intergenic
966700612 3:182845964-182845986 CATACACTGATTGGATCAAAAGG + Intronic
967173436 3:186842211-186842233 CAGACAGTGAGTGCTTCAGAAGG - Intergenic
967840582 3:194002036-194002058 CAGACAAATAGTGGAGAAGAAGG - Intergenic
968040961 3:195588951-195588973 CAGAGACTGAGCAGAGAAGAAGG + Intergenic
968939996 4:3632780-3632802 CAGACACAGAGAGGAGGAGAAGG + Intergenic
969626351 4:8307675-8307697 CCCACTCTGGGTGGAGCAGAGGG - Intergenic
970167936 4:13259667-13259689 CAGATTCTCATTGGAGCAGAGGG + Intergenic
971330497 4:25677479-25677501 GAGACAGAGAGTGGGGCAGATGG + Exonic
972624772 4:40785987-40786009 GAGACGCTGAGTGAAGAAGAGGG + Intronic
973337073 4:48967474-48967496 CAGAGATTGAGTGGGGAAGAAGG + Intergenic
973639323 4:52887443-52887465 GAGACACTGAGGGGACAAGAAGG + Intronic
973960043 4:56100699-56100721 CATACACAGAGAGGAGAAGATGG + Intergenic
975034316 4:69661609-69661631 CAGACAGTGAGTGCAGCCCACGG - Intergenic
975784806 4:77876703-77876725 CAGAATCTGAATGGAGTAGAGGG + Intronic
977283753 4:95075230-95075252 CAGACTCTGAGAAGAACAGATGG - Intronic
979277972 4:118835049-118835071 CAGAAACAAAGTGGACCAGAAGG - Intronic
980625596 4:135371405-135371427 CTGACACAGACAGGAGCAGAGGG - Intergenic
981286085 4:143020511-143020533 CAGTGACTGGGAGGAGCAGATGG + Intergenic
981610303 4:146586939-146586961 CAGAGAAGGAGTAGAGCAGATGG - Intergenic
981989970 4:150906871-150906893 CATAGTCTGAATGGAGCAGAGGG + Intronic
982142977 4:152346674-152346696 CTGACAATGAGGGGAGGAGAAGG - Intronic
982384942 4:154790427-154790449 AAGTCAGTGAGTGGAGCAGATGG - Intronic
983210573 4:164953946-164953968 CATGCACTGAGTGGAGCATAAGG - Intergenic
983370847 4:166856149-166856171 CAGAGACTGAGGGGAGGAGGAGG + Intronic
984065453 4:175042802-175042824 CAGGCACTGCGGGGAGGAGATGG - Intergenic
984788422 4:183591430-183591452 CAGAAACTGAGTGGACCGAAAGG + Intergenic
984969436 4:185174075-185174097 GAGACACTGAGTGGGGCACAGGG - Intronic
985698674 5:1357661-1357683 CAGGCACTGCGGGGAGGAGAGGG + Intergenic
985985878 5:3515867-3515889 CAGACACAGAGTGAAGAAGAGGG + Intergenic
986196984 5:5546384-5546406 CAGACACTGCGTGGACCACCTGG + Intergenic
986271135 5:6232383-6232405 CAAACACTGAGTGGAGAAGATGG + Intergenic
986271174 5:6232541-6232563 CAACCACTGAGTGGAGAAGATGG + Intergenic
986271193 5:6232616-6232638 CAACCACTGAGTGGAGAAGATGG + Intergenic
986271212 5:6232691-6232713 CATCCACTGAGTGGAGAAGATGG + Intergenic
986271231 5:6232766-6232788 CATCCACTGAGTGGAGAAGATGG + Intergenic
986323991 5:6657837-6657859 CAGACACTGAGAGCAGGAAATGG - Intronic
988602022 5:32649067-32649089 CAGGCACTGATTGTGGCAGAGGG - Intergenic
988602132 5:32649763-32649785 CAGGCACTGATTGTGGCAGAGGG + Intergenic
988962268 5:36382018-36382040 CACACACTGAGTAGTGCAGCAGG + Intergenic
989233794 5:39120264-39120286 CAGAGACAGAGAGGAGGAGAGGG + Intronic
990662032 5:58026710-58026732 ATGACACTGGGTAGAGCAGAGGG + Intergenic
993308203 5:86295898-86295920 AAGAAACAGAGGGGAGCAGAAGG - Intergenic
993758375 5:91761461-91761483 TAAACAGTGAGTGGAACAGAAGG - Intergenic
995439245 5:112172044-112172066 CAGCCACTGAGTTGACCAAATGG + Intronic
997157128 5:131573051-131573073 CAGAGACTGAAAGGAGCAGATGG - Intronic
998513293 5:142731540-142731562 CAGACACTGCAGGGAACAGATGG - Intergenic
998525945 5:142843325-142843347 CTGACACTGAGTGGAGTTCAGGG + Intronic
999308217 5:150534602-150534624 CAGACCCTGAATTGTGCAGATGG + Intronic
999317618 5:150594376-150594398 CAGACTCTGAGTAGCTCAGAGGG + Intergenic
999444424 5:151628070-151628092 CAGACACTGACTGGGGCACCAGG + Intergenic
999745444 5:154588282-154588304 TAGACACCGAGTGGCGTAGAGGG + Intergenic
1000237543 5:159376529-159376551 CAGCCACTGTGGGGAACAGAGGG - Intergenic
1000745884 5:165032737-165032759 AAGACACAGAGTGGAGTTGAGGG + Intergenic
1001384614 5:171328531-171328553 CAGCCACTGAGTAGGGCACATGG - Intergenic
1001716180 5:173818152-173818174 CAGACACTGAGGAGGGCTGATGG + Intergenic
1002094438 5:176822790-176822812 CAGACAATGAGGGGAGGAGAAGG + Intronic
1003073197 6:2960614-2960636 CAGACATTTCCTGGAGCAGATGG + Exonic
1003583327 6:7362531-7362553 CAGGCTGTGAATGGAGCAGATGG + Intronic
1003966821 6:11259996-11260018 CTGACACTGAGACTAGCAGATGG - Intronic
1005653212 6:27904122-27904144 CATACACTGAGTTGACCACAGGG - Intergenic
1005836575 6:29713989-29714011 CAGACCCTGGGTGGTGCAGATGG - Intergenic
1005845248 6:29771953-29771975 CAGCCCCTGGGTGGTGCAGATGG - Intergenic
1005960294 6:30688849-30688871 CACACACTGGGTGGCGCAGGTGG + Exonic
1006038068 6:31229700-31229722 CACACACAAAGTGGAGCTGAGGG + Intergenic
1006042381 6:31267171-31267193 CAGGCACTCAGTGGAGGACATGG - Intergenic
1006406605 6:33849217-33849239 CAGACACGGAGTGGTGTAGATGG + Intergenic
1007305738 6:40902866-40902888 CAGACAGAGGGTGGAGGAGAGGG - Intergenic
1007509811 6:42366278-42366300 GAGACACTGTGTTGAGCAGCGGG - Intronic
1008077847 6:47164364-47164386 GAGACTCTGTGTGAAGCAGAAGG - Intergenic
1008578351 6:52882571-52882593 CAGACACTGGGTGGATGATATGG + Intronic
1011551839 6:88537403-88537425 CAGACACTTGGTGGAGGAGGGGG - Intergenic
1011652111 6:89516189-89516211 GATAGACTGAGTAGAGCAGATGG + Intronic
1011969231 6:93200300-93200322 AAGAAACTGAGTGGAGAAGATGG + Intergenic
1012690113 6:102299907-102299929 CAGACCCTGAGACTAGCAGAGGG + Intergenic
1013189369 6:107789266-107789288 CAGACACTAAGCAGAGCACAGGG + Intronic
1015713714 6:136168698-136168720 CAGACACTGATTGCAGATGAGGG + Intronic
1016095694 6:140033718-140033740 CTGAGACTGAGCAGAGCAGAGGG + Intergenic
1018648849 6:165973930-165973952 CAGACAATGACTGGTGCACAAGG - Intronic
1019062767 6:169268272-169268294 GGAACACTGAGTAGAGCAGATGG - Intergenic
1019483824 7:1278691-1278713 TGGACTCTGAGTGAAGCAGACGG + Intergenic
1019574326 7:1729120-1729142 CTGGCAGTGAGTTGAGCAGAGGG - Intronic
1019634443 7:2067985-2068007 CAGACACGGTGTGGAAGAGAAGG + Intronic
1019744906 7:2694205-2694227 CAGACCCTGAATAGAACAGACGG + Intronic
1021524691 7:21574292-21574314 CAGAGACTAAGTGGAGCCAAGGG - Intronic
1022419434 7:30206566-30206588 CAGTCACTGAAGGGAGCAGAGGG + Intergenic
1023620882 7:42071323-42071345 CAAACACTGGGTGGAGGAGGCGG + Intronic
1024303574 7:47907200-47907222 CAGCCACTGTGTGGAACAGCTGG + Intronic
1026824778 7:73574583-73574605 CAGGCATTGAGTGGAACAGCAGG + Intronic
1027158607 7:75786086-75786108 CAGAGACTGAGTATAGCTGAAGG - Intronic
1027735485 7:81927607-81927629 CACACACTGACTGGAGTAAATGG - Intergenic
1028446474 7:90929201-90929223 CAGACACTGGGTGCAGCCCACGG - Intronic
1031337963 7:120560750-120560772 GAGACACTGAGAGGAACACATGG - Intronic
1033215630 7:139491403-139491425 CAGAGACTGAGGGTAGCAAAGGG + Intergenic
1035284699 7:157798880-157798902 GAGTCCCTGAGTGGAGCCGATGG - Intronic
1036785686 8:11684590-11684612 CAGCCAGTGAGTGGAGGAGATGG - Intronic
1036827845 8:11992469-11992491 CAGACACTGAGGGAGACAGAGGG - Intergenic
1036961616 8:13250281-13250303 CAGAAGCTTAGTGGAGCAGATGG - Intronic
1037842627 8:22256127-22256149 CAGAGACTGGCTGGAGCTGAGGG + Intergenic
1037988641 8:23305353-23305375 CAAACACTCAGGGGAGCAGCTGG + Intronic
1039235809 8:35501434-35501456 GAGCCCCTGAGTGGAGCAGTGGG + Intronic
1039584779 8:38697252-38697274 CAGACAATGAGTTGTCCAGAGGG - Intergenic
1041834684 8:62198254-62198276 CAGTCACTGATGGGAGCAGCAGG + Intergenic
1041873109 8:62657901-62657923 CAGGCATTTAGTGGAGCAAATGG + Intronic
1042665031 8:71195208-71195230 CAGCTGCTGAGTGGAGAAGAGGG - Intergenic
1042737768 8:72008010-72008032 CAGCTACTGAATTGAGCAGAGGG + Intronic
1044277164 8:90315104-90315126 CATACACTCAGTGCAGCGGAAGG + Intergenic
1047057657 8:121184358-121184380 CAGACAGTGAGTGGTGGAGGTGG - Intergenic
1047318398 8:123755221-123755243 CAGAGACTGAGGGGGGCTGAGGG - Intergenic
1047762331 8:127963337-127963359 CAGACACTGAGAGAAGCACCAGG - Intergenic
1048173111 8:132127317-132127339 CAGACATTGTGAGCAGCAGAAGG - Exonic
1048712927 8:137232395-137232417 CAGACACTGAGAGGAACTGAGGG - Intergenic
1050574175 9:6975647-6975669 CAGACACTGTGTGTAGCTCATGG + Intronic
1051000686 9:12278674-12278696 CAGTGACTGAGGGGAGAAGATGG - Intergenic
1051610477 9:18957120-18957142 AAGACTCTGAGTGTAGCTGAGGG - Intronic
1052072227 9:24095354-24095376 AAGAGATTCAGTGGAGCAGAAGG + Intergenic
1052819794 9:33129551-33129573 CAGTCAGTGAGTGGAGCACGGGG - Intronic
1053120712 9:35545761-35545783 CAGACACTGAGTTGGGCATTAGG - Intronic
1054450756 9:65402498-65402520 CAGACACAGAGAGGAGGAGGAGG - Intergenic
1055506207 9:76951959-76951981 CAAACCCTCAGTTGAGCAGAAGG + Intergenic
1058391866 9:104504579-104504601 CACACACTCAGTGGAGCCCATGG - Exonic
1060819327 9:126652258-126652280 CAGCCCCTGTGTGGAGCAGCAGG + Intronic
1061200836 9:129137611-129137633 CAGACACTTTGTGGATGAGAAGG + Exonic
1061568048 9:131457315-131457337 TAGAGACTGATTGGAGCAGTAGG + Intronic
1062191292 9:135249177-135249199 CAGAGACTGAGTCATGCAGAGGG + Intergenic
1189152332 X:38721149-38721171 CAGAGAATGAGTAGAGCAAAAGG + Intergenic
1189969351 X:46402164-46402186 AGGATACTGAGAGGAGCAGATGG - Intergenic
1190154714 X:47980282-47980304 CAGACACTGGGAGGTGAAGAGGG + Intronic
1192522898 X:71816831-71816853 CAGACACTGGGTGCAGCCCATGG + Intergenic
1192910916 X:75603140-75603162 CAGAAAGTGAGTGGGGCTGATGG + Intergenic
1193388005 X:80893607-80893629 CAGACAGTGAGTGCAGCCCATGG - Intergenic
1194146249 X:90268636-90268658 CAGAAACTCTGTGGAGAAGAGGG - Intergenic
1194206773 X:91019560-91019582 CAGCCACAGTGTGGAGAAGAAGG - Intergenic
1194289815 X:92057072-92057094 CAGACACTGAAGTGAGGAGAAGG + Intronic
1196709694 X:118750010-118750032 GAGAAACTGAGTGGAGTATATGG - Intronic
1198622287 X:138526819-138526841 GTGACACTTAGTGGAACAGAAGG - Intergenic
1199896287 X:152130686-152130708 CAGACACTGTCTGGGGTAGAGGG - Intergenic
1199964904 X:152811730-152811752 CAGACACAGACTTGTGCAGAGGG + Intergenic
1200135628 X:153873296-153873318 CAGCCCCAGAGTGGGGCAGATGG + Intronic
1200161228 X:154010825-154010847 CAGGCACTGATTGTGGCAGAGGG - Exonic
1200491991 Y:3837907-3837929 CAGAAACTCTGTGGAGAAGAGGG - Intergenic
1200552522 Y:4594349-4594371 CAGCCACAGTGTGGAGAAGAAGG - Intergenic
1200607329 Y:5281648-5281670 CAGACACTGAAGTGAGGAGAAGG + Intronic