ID: 948359768

View in Genome Browser
Species Human (GRCh38)
Location 2:237412020-237412042
Sequence GCCAGGAAGCAGACACTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 740}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359768_948359770 -2 Left 948359768 2:237412020-237412042 CCACTCAGTGTCTGCTTCCTGGC 0: 1
1: 0
2: 6
3: 55
4: 740
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359768_948359773 21 Left 948359768 2:237412020-237412042 CCACTCAGTGTCTGCTTCCTGGC 0: 1
1: 0
2: 6
3: 55
4: 740
Right 948359773 2:237412064-237412086 AAAGGAGAGAACTAAACCTCTGG 0: 1
1: 0
2: 5
3: 27
4: 285
948359768_948359771 3 Left 948359768 2:237412020-237412042 CCACTCAGTGTCTGCTTCCTGGC 0: 1
1: 0
2: 6
3: 55
4: 740
Right 948359771 2:237412046-237412068 TCTCGACCATGAGTGAGGAAAGG 0: 1
1: 1
2: 0
3: 3
4: 111
948359768_948359774 22 Left 948359768 2:237412020-237412042 CCACTCAGTGTCTGCTTCCTGGC 0: 1
1: 0
2: 6
3: 55
4: 740
Right 948359774 2:237412065-237412087 AAGGAGAGAACTAAACCTCTGGG 0: 1
1: 0
2: 0
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359768 Original CRISPR GCCAGGAAGCAGACACTGAG TGG (reversed) Intronic
900294407 1:1941688-1941710 GGCAGGTAGCAGACCCTCAGTGG + Intronic
900476110 1:2877114-2877136 GCCAGGAACCAGGCACAGAGTGG - Intergenic
900789841 1:4672657-4672679 GCCTGGATGCACACACTGGGAGG - Intronic
900936363 1:5768697-5768719 GCCTGGAAGGAGACGATGAGGGG - Intergenic
900986610 1:6076857-6076879 ACCAGGATGCAGCCACAGAGCGG + Intronic
901164371 1:7207335-7207357 GCCAGGTTGCTGACACTGACAGG + Intronic
901805566 1:11736424-11736446 GCCAGCAGGGCGACACTGAGGGG + Intronic
901966654 1:12873836-12873858 GCCAGGAAGCTGGAACTGGGTGG - Intronic
901982049 1:13044085-13044107 GCCAGGAAGCTGGAACTGGGTGG - Intronic
902000033 1:13184828-13184850 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
902019288 1:13330595-13330617 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
902136261 1:14308659-14308681 GCAAGGAAACAGGCACAGAGAGG - Intergenic
902674796 1:18001250-18001272 GCTAGGCAGCAGGCACTAAGAGG - Intergenic
902978839 1:20108953-20108975 GCCAGGAACCAAAAACTGAAAGG + Intergenic
904365490 1:30008392-30008414 TCTGGGAAGCAGACACTAAGAGG - Intergenic
904430159 1:30459226-30459248 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
904434403 1:30484926-30484948 ACCAGGAAGGAGGCCCTGAGTGG - Intergenic
905355455 1:37380716-37380738 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
905816450 1:40954704-40954726 ATCTGGAAGCAGACTCTGAGAGG + Intergenic
905877305 1:41440705-41440727 GCCAGGAAGCAGAAGCAGGGTGG + Intergenic
906361391 1:45162816-45162838 GCCAGGAAGCTCAAACTGGGTGG + Intronic
906570122 1:46830825-46830847 GCCAGGAAGCTCAAACTGGGCGG - Intergenic
906753662 1:48288842-48288864 GCCAGGAAGCTGAAACTGGGTGG + Intergenic
906892977 1:49738402-49738424 GCCAGGAAGCTCAAACTGGGTGG + Intronic
907436043 1:54448912-54448934 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
908459001 1:64331039-64331061 GCCTTGAAGCAGACAGGGAGAGG - Intergenic
908639314 1:66204492-66204514 GCCAGGAAGCTCAAACTGGGTGG - Intronic
908937648 1:69395110-69395132 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
908975133 1:69888142-69888164 GCCAGGAAGCTCAAACTGGGTGG - Intronic
908977053 1:69910846-69910868 GCCAGGAAGCTCAAACTGGGTGG - Intronic
908978725 1:69928456-69928478 GCCATGAAGCTCAAACTGAGTGG - Intronic
909453930 1:75829281-75829303 GCCAGGAAGCTCAAACTGGGTGG + Intronic
909485497 1:76168912-76168934 CCCAGGTAAAAGACACTGAGTGG - Intronic
909914588 1:81301637-81301659 GCTGGGAAACAAACACTGAGAGG + Intergenic
910367119 1:86477883-86477905 GACCGGAAGCAGACATGGAGAGG - Intronic
910627669 1:89325616-89325638 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
910727710 1:90356103-90356125 GCCAGGCAGCATACAATGAAAGG + Intergenic
910915129 1:92279953-92279975 GCCTGGAAGCACAAACTGGGCGG + Intronic
910941313 1:92538159-92538181 GCCAGGAAGAAGACATTCAGTGG - Intronic
911033056 1:93510079-93510101 GCCAGGAAGCTCAAACTGGGTGG + Intronic
911396366 1:97315524-97315546 TCCAGGAATCAGACACAGAGAGG - Intronic
911658756 1:100476000-100476022 GCCAGCCAGCAAAGACTGAGAGG - Intronic
911700765 1:100949665-100949687 GCCAGGAAGCTCAAACTGGGAGG - Intronic
911867865 1:103051246-103051268 GCCAGGAAGCTCAAACTGGGTGG - Intronic
912614026 1:111079151-111079173 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
913092806 1:115491325-115491347 GCCAGGGAGCACACATTCAGAGG - Intergenic
913103697 1:115593456-115593478 GCCAGCAAGCAGATCGTGAGTGG - Intergenic
913105329 1:115609107-115609129 TCCAGGAAGCAGATGCTGAGAGG - Intergenic
913200356 1:116491077-116491099 GGCAGGAGGCAGACTCAGAGAGG - Intergenic
913434415 1:118831914-118831936 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
913704130 1:121401928-121401950 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
914408631 1:147402873-147402895 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
914878830 1:151532306-151532328 GTCAGGAAGGAGACCCTTAGGGG + Intronic
915480089 1:156178523-156178545 ACCAGGAAAGAGAGACTGAGTGG - Intergenic
915757809 1:158279694-158279716 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
915807021 1:158864794-158864816 GCCAGGAAGCACAAACTGAGCGG + Intergenic
916207808 1:162332256-162332278 GCCAGGGAGGTCACACTGAGAGG - Intronic
916330251 1:163608017-163608039 GCCTGGATCCAGACACTGGGAGG + Intergenic
916438226 1:164796680-164796702 TTCTGGAAGCAGACACTGAAAGG - Intronic
916471672 1:165129636-165129658 CCCAGCAAGCAGACATGGAGTGG + Intergenic
916757897 1:167790600-167790622 GCCAGGACGAAGACATGGAGAGG - Exonic
917299727 1:173560648-173560670 TCCTGGAAGCAGATTCTGAGAGG - Intronic
917549345 1:176007868-176007890 GCCAGGAAGCTGGAACTGGGTGG - Intronic
918495964 1:185136331-185136353 CCCAGGAAGCAGAGGTTGAGTGG + Intronic
918855828 1:189755283-189755305 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
919603190 1:199647808-199647830 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
919822506 1:201482051-201482073 GCCAGGAAGCACTCACTGGACGG - Intergenic
920039968 1:203089332-203089354 GCCAGGGAACTGACACAGAGTGG - Intergenic
920412456 1:205773106-205773128 CCCAAGAAGAAGACACTGTGTGG + Intronic
920588830 1:207196427-207196449 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
920900519 1:210106136-210106158 CCTGGGAAGCAGACTCTGAGAGG + Intronic
921353693 1:214264080-214264102 TCCCAGGAGCAGACACTGAGAGG - Intergenic
921475267 1:215599631-215599653 GCAAGGAAGCAGCCACTGTGTGG - Intronic
922682285 1:227610629-227610651 GACAGGAAATAGTCACTGAGAGG - Intronic
922798474 1:228353171-228353193 TCCAGGCAGCAGACCCTGACTGG - Intronic
924852954 1:247848960-247848982 TCCAGCAAGCAGACACTGAGTGG + Intergenic
1063605635 10:7520726-7520748 CCCGGGAATCAGACTCTGAGAGG - Intergenic
1064840562 10:19586750-19586772 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1064864269 10:19861379-19861401 GGAAGGAAGGAGACACTGACTGG - Intronic
1064895091 10:20226814-20226836 GACAGGAGGCGGACACTGAAAGG - Intronic
1065157587 10:22886134-22886156 GCCAGGAAGCGCAAACTGGGTGG + Intergenic
1065463684 10:25996147-25996169 GCCAGGAAGCTGGAACTGCGTGG - Intronic
1065998669 10:31083944-31083966 GACAGGAAGCAGACAGAAAGGGG - Intergenic
1066139358 10:32488129-32488151 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1066168563 10:32816333-32816355 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1066220958 10:33335859-33335881 GGCCGGGAGCGGACACTGAGAGG - Intronic
1066595951 10:37050149-37050171 GCCAGGAAGCTCATACTGGGTGG - Intergenic
1067172554 10:43920420-43920442 GCCAGGAAGCTAAAACTGGGTGG - Intergenic
1067175822 10:43944751-43944773 GCCAGGGAGCAGATCCTGTGGGG + Intergenic
1067325922 10:45266280-45266302 GCCAGGAAGCATGAACTGGGTGG + Intergenic
1067661616 10:48240364-48240386 GCAAGGATGCAGACACTCCGGGG + Exonic
1067810701 10:49425263-49425285 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1067845339 10:49715409-49715431 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1067903125 10:50262878-50262900 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1068115765 10:52736025-52736047 GCCAGGAAGCTGAAACTGGGTGG - Intergenic
1068477949 10:57551924-57551946 GCCAGGAAGCTTAAACTGGGTGG - Intergenic
1068576225 10:58687514-58687536 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1068934252 10:62620751-62620773 CACAGGAAGAAGACACAGAGAGG + Intronic
1069084256 10:64120764-64120786 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1069227170 10:65959037-65959059 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1069300349 10:66899842-66899864 GCCAGGAAGCTCAAACTGAGCGG + Intronic
1069526964 10:69180683-69180705 CGAAGGAGGCAGACACTGAGAGG - Intronic
1069709860 10:70481254-70481276 GCCAGGAACCAGACACAGGTGGG + Intronic
1069906610 10:71735928-71735950 GCCAAGGGGCAGACACTCAGGGG + Intronic
1070474161 10:76815646-76815668 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1070651335 10:78238889-78238911 GCCAGGCAGCAGTCCCTCAGTGG + Intergenic
1070956441 10:80466719-80466741 CCCAGGACGCAGACACTCACTGG - Intronic
1070963943 10:80518113-80518135 ACCAGCAAGCAGAAACAGAGAGG - Exonic
1071082957 10:81834616-81834638 GACAGGAAGCAGGTACTGAGAGG + Intergenic
1071838592 10:89445090-89445112 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1072361384 10:94663209-94663231 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1072377237 10:94830179-94830201 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1072382797 10:94892841-94892863 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1072384917 10:94914773-94914795 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1072610502 10:97014417-97014439 GCCAGGGAGCGGGCACAGAGGGG + Intronic
1072819447 10:98541810-98541832 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1072859092 10:98983989-98984011 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1073121168 10:101123328-101123350 GCGAGGAAGCTGACACCGGGAGG - Intronic
1073475048 10:103747251-103747273 TCCAGGACGCAGACACAGTGGGG + Intronic
1073987315 10:109224092-109224114 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1074877110 10:117622080-117622102 TCCCTGAAGCTGACACTGAGTGG + Intergenic
1074956623 10:118397100-118397122 ACCAGGTAGCAGAGGCTGAGGGG + Intergenic
1075198424 10:120380703-120380725 GCCAGGAAGCAGAGAAAGGGAGG - Intergenic
1075262603 10:120976215-120976237 GCCAGGAAGCAGAGATTCAATGG - Intergenic
1075451220 10:122553090-122553112 GACAGGAAGCAGGCACTGGGTGG + Intergenic
1076590936 10:131581623-131581645 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1076764315 10:132624831-132624853 GCCAGGAGGGTGACACTGTGGGG - Intronic
1077236165 11:1482944-1482966 GGCAGGAAGCAGTCACTCTGAGG + Intronic
1077358058 11:2127731-2127753 GCCCTGAAGCAGACCCAGAGAGG + Intergenic
1077784969 11:5373821-5373843 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1077983955 11:7332039-7332061 TCCTGGAAGCAGAAGCTGAGAGG + Intronic
1078166412 11:8889739-8889761 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1078605125 11:12768512-12768534 GACAGGAAGCTGAGTCTGAGAGG + Intronic
1079848658 11:25501636-25501658 GCCAGGAAGCACGAACTGGGGGG - Intergenic
1080460840 11:32453551-32453573 GCCAAGAAGCAAAAACTCAGGGG + Intergenic
1081988605 11:47325448-47325470 GCCAGGCCGCAGACCCTCAGGGG + Intronic
1082122203 11:48391533-48391555 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1082123232 11:48402826-48402848 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1082135777 11:48547547-48547569 GCCAGGAAGCTCGAACTGAGTGG - Intergenic
1082150619 11:48734470-48734492 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1082321612 11:50818865-50818887 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1082556927 11:54574107-54574129 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1082641550 11:55667193-55667215 CCCTGGAACCAGACACCGAGGGG + Intergenic
1082860232 11:57848320-57848342 GCCAGGAAGCTTGAACTGAGTGG + Intergenic
1083009898 11:59387292-59387314 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1083623110 11:64058688-64058710 GCCAGGGAGCAGGAAATGAGCGG - Intronic
1084554443 11:69867566-69867588 GCAGGGAAGCAGAGGCTGAGAGG + Intergenic
1084744566 11:71160554-71160576 GCCAGGAAGCAGTCCCTCAATGG + Intronic
1084861609 11:72022430-72022452 AACAGGAGGCAGTCACTGAGTGG + Intronic
1085406975 11:76269257-76269279 GCCAGGAAGGAGCCAGTGACTGG - Intergenic
1086298241 11:85395755-85395777 GCCAGGAAGCACAAACTGGGTGG + Intronic
1086417000 11:86598441-86598463 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1087324196 11:96700947-96700969 CCCAGGAGGCAGACACTCAAAGG - Intergenic
1088884900 11:113998901-113998923 AGCAGGAAGCAGCCGCTGAGAGG + Intergenic
1089184063 11:116602981-116603003 TCCAGGAAACAGCCTCTGAGTGG + Intergenic
1089452143 11:118606294-118606316 GCCAAGCAGCAGACAAGGAGGGG - Intergenic
1090308889 11:125717148-125717170 GCCTGGAAGCTGAAACTGGGTGG - Intergenic
1090579116 11:128140533-128140555 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1091034235 11:132218700-132218722 CTCAGGAAGCAGATACAGAGTGG - Intronic
1091052315 11:132383902-132383924 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1091172549 11:133531507-133531529 AACAGGAAGGAGATACTGAGAGG + Intronic
1091330667 11:134728885-134728907 GCCAGGCAGGGGACACTGAGAGG - Intergenic
1091408672 12:224709-224731 GCCAGTAAGAATACAGTGAGAGG - Intronic
1091829508 12:3539713-3539735 ACCAGGGAGCAGACAGTGATGGG + Intronic
1092079013 12:5697952-5697974 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1092140554 12:6180527-6180549 GCCAGGCAGGACACACCGAGTGG - Intergenic
1092308913 12:7331282-7331304 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1092325732 12:7529011-7529033 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1092327078 12:7544103-7544125 GCCAGGAAGCACGAACTGGGTGG + Intergenic
1092522657 12:9290141-9290163 GGCTGAAAGCAGGCACTGAGGGG - Intergenic
1092544628 12:9441756-9441778 GGCTGAAAGCAGGCACTGAGGGG + Intergenic
1092560787 12:9610803-9610825 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1092601524 12:10071464-10071486 CCCAAGAAGCAGAGACTGTGTGG - Exonic
1093900407 12:24625271-24625293 GCCAGGAAGCTTGAACTGAGTGG - Intergenic
1094377845 12:29810207-29810229 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1094508321 12:31080314-31080336 GGCTGAAAGCAGGCACTGAGGGG - Intronic
1094579242 12:31718823-31718845 GCAAGGAAGCTCACACTGGGCGG - Intronic
1094737746 12:33254273-33254295 GCCAGGAAGCAGAAACTTCCTGG - Intergenic
1095165685 12:38969114-38969136 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1095321821 12:40837765-40837787 GCCAGGAAGCAAGCACTGCTAGG + Intronic
1095424792 12:42063466-42063488 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1095830938 12:46585977-46585999 GCCTGGAAGCAGGAACTGGGTGG - Intergenic
1095913924 12:47457443-47457465 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1096241980 12:49964483-49964505 ACCAGCACGCAGACACCGAGGGG - Intronic
1096650697 12:53060713-53060735 GCCAGGACTCAGTCTCTGAGTGG - Exonic
1097187052 12:57201690-57201712 GTGAGGGAGCAGCCACTGAGGGG - Intronic
1097194058 12:57234148-57234170 GGGAGGGAGCAGACAGTGAGTGG - Intronic
1097321628 12:58232584-58232606 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1097740831 12:63240869-63240891 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1097912143 12:64982012-64982034 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1098016938 12:66115044-66115066 TCCAGGAAGCAGAGACTGAGAGG - Intergenic
1098186360 12:67900690-67900712 GCCAGGAAGCTCAAACTGGGCGG + Intergenic
1098494490 12:71118553-71118575 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1098993884 12:77096105-77096127 GCCAGGAAGCTCAAACTGGGCGG - Intergenic
1099242183 12:80151242-80151264 GATAGGAAGCAGAGACTAAGAGG + Intergenic
1099795472 12:87394424-87394446 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1100427151 12:94498040-94498062 GCCATGGAGCTGGCACTGAGAGG - Intergenic
1102691403 12:114763983-114764005 GACTGGAAGGAGACACTGTGGGG + Intergenic
1103728620 12:123011752-123011774 GCCGGCAAGCAGACACTGAAGGG + Intronic
1104974276 12:132545519-132545541 AACAGCAAGGAGACACTGAGGGG - Intronic
1105603040 13:21903905-21903927 CCCAGGAAGCAGAGAGGGAGCGG + Intergenic
1105789093 13:23779955-23779977 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1105992624 13:25637604-25637626 GCCAGGAAGCTCAAACTGTGTGG + Intronic
1106380168 13:29229044-29229066 GCCATGAAGTTAACACTGAGGGG + Intronic
1106616123 13:31329627-31329649 GCCAGGCAGGAGACACAGAAAGG + Exonic
1107090480 13:36473930-36473952 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1108131456 13:47305786-47305808 AACAAGAAGCAGACACTGAAAGG + Intergenic
1108858252 13:54822184-54822206 GCCAGGAAGTTGACACTGGGTGG + Intergenic
1108988779 13:56629160-56629182 GCCAGGAAGCTCGAACTGAGTGG + Intergenic
1109363267 13:61324042-61324064 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1109816240 13:67588809-67588831 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1109972004 13:69782657-69782679 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1111375126 13:87368378-87368400 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1111416722 13:87956516-87956538 GCCAGGTACCAGACAATGTGGGG + Intergenic
1112835391 13:103508146-103508168 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1112899959 13:104346004-104346026 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1112956803 13:105070444-105070466 GTCAGGAAGCAAACACTTAAGGG - Intergenic
1112980826 13:105382751-105382773 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
1113584870 13:111458274-111458296 GACAGGTACCAGACACTTAGGGG + Intergenic
1114171855 14:20280529-20280551 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1114749172 14:25183904-25183926 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1114972418 14:28049712-28049734 GACAGGAAGCAGATACTGAGGGG - Intergenic
1116292621 14:43062815-43062837 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1116540959 14:46101044-46101066 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1117452157 14:55862105-55862127 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1117468595 14:56019541-56019563 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
1117511392 14:56454932-56454954 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1117690480 14:58299638-58299660 GCCAGGACGCAGGAGCTGAGGGG - Intronic
1117974253 14:61281538-61281560 GCCAGGTAGGAGCCACTCAGAGG - Exonic
1118528479 14:66673506-66673528 TCCAGTAAGCATACACTGCGTGG - Intronic
1119156338 14:72415184-72415206 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1120709755 14:87781096-87781118 GCCAGGAAGCACGAACTGGGTGG - Intergenic
1120763589 14:88307990-88308012 GTTGGGAAGCAGACACAGAGAGG + Intronic
1121298893 14:92853306-92853328 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1122025588 14:98873389-98873411 CCCAAGGAGCAGACACTCAGCGG - Intergenic
1122152985 14:99734630-99734652 GCCAGACAGCAGGCACTGAGAGG + Intergenic
1122304363 14:100752681-100752703 CCCTGGAAGTATACACTGAGTGG + Intergenic
1122798179 14:104216749-104216771 GCCGGGATGCAGACACTGCCCGG - Intergenic
1123122746 14:105925613-105925635 CCCAGGCAGCAGCCACAGAGGGG + Intronic
1123405389 15:20017034-20017056 CCCAGGCAGCAGCCACAGAGGGG + Intergenic
1123514719 15:21023682-21023704 CCCAGGCAGCAGCCACAGAGGGG + Intergenic
1123822377 15:24043677-24043699 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1123968361 15:25481052-25481074 GCCAGCAAGCAGATATGGAGAGG - Intergenic
1124257865 15:28160377-28160399 GCCCGGAAGCTGAAACTGGGTGG - Intronic
1124669258 15:31623409-31623431 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1124724653 15:32145572-32145594 GCCAGGAAGCTCGAACTGAGTGG - Intronic
1125055690 15:35356927-35356949 GCCAGGAAGCTCGAACTGAGTGG - Intronic
1125352613 15:38783229-38783251 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1125754927 15:42057093-42057115 GCCAGGCAGCAGACGCTGGGGGG + Intergenic
1126257752 15:46647919-46647941 GCCAGGAACCCAAGACTGAGTGG + Intergenic
1126996455 15:54450415-54450437 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1127031780 15:54872178-54872200 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1128245211 15:66128188-66128210 GCCAGGCTGCAGACCCTTAGAGG + Intronic
1128853846 15:70990283-70990305 GCCAGGAAGCTCCAACTGAGTGG - Intronic
1128895838 15:71372921-71372943 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1129226537 15:74173808-74173830 GCCTGGAACCATCCACTGAGAGG - Exonic
1130208686 15:81902446-81902468 GCTAGGAAGCAGAGGCTGGGAGG + Intergenic
1130421221 15:83748914-83748936 TCCAGGGAGCAGACCCTGAGAGG + Intronic
1130737497 15:86565775-86565797 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1130833329 15:87625439-87625461 CCCAGGAAGAGGACACAGAGTGG + Intergenic
1130922277 15:88357553-88357575 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1131290340 15:91101314-91101336 GGCAGGAAGCAGAAACACAGAGG - Intronic
1131298389 15:91172587-91172609 TCCTGGAAGGAGACACAGAGAGG - Intronic
1132161316 15:99545599-99545621 ACCAGGGACCAGACACTAAGGGG - Intergenic
1133983322 16:10649884-10649906 GCTAGGAGGAGGACACTGAGGGG + Intronic
1134045793 16:11099913-11099935 GGCAGGAAGCAGAGACAGTGGGG + Intronic
1134879586 16:17733638-17733660 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1135080904 16:19434752-19434774 TCAAGGAAGCAGTCACTGAATGG - Intronic
1135658599 16:24274295-24274317 GTGAGGAAACAGACACAGAGAGG - Intronic
1137371471 16:47910351-47910373 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1137471088 16:48759181-48759203 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1137506230 16:49056274-49056296 GTCAGGAAACAGACTCTGTGGGG + Intergenic
1137525139 16:49228564-49228586 GCCAGGAAGCTCAAACTGTGTGG + Intergenic
1138345440 16:56317420-56317442 GCTAGGTGGCAGACACTGAGTGG - Intronic
1138851215 16:60632139-60632161 CCCAGGAGGAAAACACTGAGGGG + Intergenic
1139105276 16:63820163-63820185 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1140147437 16:72324849-72324871 GCCAGGAAGCTCAAACTGGGCGG + Intergenic
1140394482 16:74615025-74615047 GCCAGGAAGCAGACAACAAAAGG + Intergenic
1140491323 16:75338342-75338364 TCAAGGAAGCAGAGACTGAAAGG + Intronic
1140537074 16:75719600-75719622 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1140991818 16:80220182-80220204 GCCAGGAAGCGCAAACTGGGTGG + Intergenic
1141887224 16:86900797-86900819 GCCAAGAAACAGAGACAGAGCGG + Intergenic
1142250321 16:88989005-88989027 GCCATGCACGAGACACTGAGTGG - Intergenic
1142358840 16:89616771-89616793 GCCAGGAAGCAGGCAGGAAGTGG + Intronic
1142358852 16:89616826-89616848 GCCAGGAAGCGGACAGGAAGTGG + Intronic
1142358857 16:89616848-89616870 GCCAGGAAGCAGGCAGGAAGTGG + Intronic
1142358865 16:89616881-89616903 GCCGGGAAGCAGGCAGAGAGCGG + Intronic
1142610563 17:1107532-1107554 TCCAGGAGGCAGCCTCTGAGTGG + Intronic
1143374316 17:6458326-6458348 GACAGGAGGCACACAGTGAGGGG - Intronic
1144261792 17:13528630-13528652 TCCAGGAAGCAGATCCTAAGAGG - Intronic
1145396750 17:22502582-22502604 ACCAGGAAGCTCAAACTGAGTGG - Intergenic
1146156741 17:30530581-30530603 GACAGCAAGCAGTCACTGGGTGG - Intergenic
1146405283 17:32531314-32531336 GCCAGCACACAGAGACTGAGAGG + Intronic
1146600923 17:34215395-34215417 GCCAGGAAGCTCGAACTGAGTGG - Intergenic
1147198306 17:38782370-38782392 GGCAAAATGCAGACACTGAGAGG + Intronic
1149095988 17:52841601-52841623 GCCAGGCAGAAGATCCTGAGTGG + Intergenic
1149120490 17:53157985-53158007 GCCAGGAAAGAGAGACAGAGTGG - Intergenic
1149932038 17:60766849-60766871 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1150025862 17:61673516-61673538 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1150226481 17:63527307-63527329 GCCAAAAAGCTGCCACTGAGAGG - Intronic
1150778964 17:68103339-68103361 GCCAGGAATCATTAACTGAGTGG + Intergenic
1151477351 17:74351670-74351692 GCAAGAAAGTGGACACTGAGGGG + Intronic
1152307325 17:79528921-79528943 GCCCTGAAGCAGGAACTGAGGGG - Intergenic
1153135349 18:1911358-1911380 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1153402389 18:4695146-4695168 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1153541850 18:6164177-6164199 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1155146435 18:23087756-23087778 CCCAGAAAGCAGACACTGCCAGG + Intergenic
1156115969 18:33787361-33787383 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1156709381 18:39924851-39924873 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1156793901 18:41016107-41016129 GACAGGAAGAAGACACTAATGGG + Intergenic
1157186873 18:45548322-45548344 GTGAGGAAGAAGACCCTGAGAGG + Intronic
1158100193 18:53821382-53821404 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1158499229 18:57984874-57984896 GCCAAGAAGCAGAAAATGACAGG + Intergenic
1159592317 18:70348589-70348611 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1160778726 19:868502-868524 GCGGGGAGGCAGGCACTGAGCGG + Intronic
1160839704 19:1140617-1140639 GCCAGGGAGCAGGCAGAGAGCGG + Intronic
1161522167 19:4730763-4730785 ACCAGGGAACAGGCACTGAGTGG - Intergenic
1161587019 19:5111115-5111137 GCCAGGAGGCTGACCCTGGGTGG + Intronic
1163100611 19:15093868-15093890 GCCAGAAAACATACATTGAGTGG - Intergenic
1163149647 19:15403371-15403393 GGGAGGAAGCAGACACAGAGGGG + Intronic
1164248606 19:23457384-23457406 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1164307642 19:24018979-24019001 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1164331983 19:24268131-24268153 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1164568388 19:29348832-29348854 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1165053686 19:33160136-33160158 GCCACCCAGCAGACAGTGAGTGG - Intronic
1165094580 19:33403193-33403215 TGCAGGCAGCAGACACAGAGCGG + Intronic
1165111366 19:33504357-33504379 GGCAGGAGGCAGCCACTCAGAGG + Intronic
1165735716 19:38174210-38174232 TTCAGGAAGCAGACACAGAGAGG - Intronic
1165832529 19:38736612-38736634 GGCAGGGAGGAGACCCTGAGCGG - Intronic
1166446595 19:42863182-42863204 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1166584030 19:43929514-43929536 GTCAGGAAGCAGACAGAGAAAGG - Intronic
1166733785 19:45072703-45072725 ACCAGGAAGCTGACGCTCAGAGG + Intronic
1167612815 19:50515401-50515423 GGCAGGGAGCAAACCCTGAGCGG - Intergenic
1167781297 19:51600976-51600998 GCCAGGATCCAGAGACAGAGAGG - Intergenic
1168369843 19:55822880-55822902 GCCAGGAAGCTGGAACTGGGGGG + Intronic
925091092 2:1156592-1156614 GCCAGGGTGCAGCCACAGAGCGG + Intronic
925239176 2:2307470-2307492 GGCAGGAAGTAGCCACTGATTGG + Intronic
925299116 2:2797645-2797667 GGCAGGAAGCAGGCTCAGAGTGG - Intergenic
926219996 2:10929155-10929177 GCCAGGAAGTGGGCAGTGAGCGG - Intergenic
926232694 2:11016939-11016961 CCCAGGCAGCAGGCTCTGAGGGG + Intergenic
926534935 2:14099614-14099636 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
926767508 2:16335158-16335180 CTCTGGAAGCAGATACTGAGAGG - Intergenic
927236001 2:20875488-20875510 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
927426262 2:22984632-22984654 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
928765053 2:34635789-34635811 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
928818259 2:35325398-35325420 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
929025727 2:37599843-37599865 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
929557762 2:42936245-42936267 GCCAGGAAGGAGAAACGGACTGG - Intergenic
929658912 2:43763284-43763306 GCCAGGAAGCACACACAGGTGGG + Intronic
929929331 2:46239877-46239899 GGCAAGCACCAGACACTGAGTGG + Intergenic
930837941 2:55814501-55814523 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
931469212 2:62521174-62521196 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
931971259 2:67589396-67589418 GCTAGGAAGCTCAAACTGAGCGG + Intergenic
932182926 2:69665395-69665417 GCCAGGCAACACACTCTGAGTGG + Intronic
932377540 2:71251066-71251088 GCCAGGAAGCACAAACTGGGTGG - Intergenic
932660512 2:73647847-73647869 GCCAGGAAGCACGAACTGGGTGG - Intergenic
932868691 2:75374545-75374567 GCCTGGAAGCACAAACTGGGTGG - Intergenic
933274103 2:80265583-80265605 GCCAGTAAGCAGACAAGGGGTGG - Intronic
933519082 2:83347955-83347977 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
933752256 2:85610525-85610547 GTCAGGAAACAGGCACAGAGAGG - Intronic
934527119 2:95058829-95058851 GACAGGAAGCTGAGGCTGAGAGG - Intergenic
935419413 2:102851878-102851900 ACCAGGAAGGAGGCAATGAGAGG + Intergenic
935450259 2:103201034-103201056 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
935457200 2:103283579-103283601 ACCAGAAAGATGACACTGAGAGG + Intergenic
936293605 2:111248215-111248237 GCCAGAAAGCAGACCCAGGGAGG - Intergenic
936617340 2:114061503-114061525 TTCCAGAAGCAGACACTGAGAGG + Intergenic
936904938 2:117525866-117525888 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
937026059 2:118698659-118698681 ACCATGCAGCAGACATTGAGTGG + Intergenic
937453010 2:122018202-122018224 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
938092050 2:128440652-128440674 TCCAGGAAGCAGATTCTGAGAGG + Intergenic
938939363 2:136155544-136155566 GCCAGGTAGCAGAAAGAGAGAGG + Intergenic
939502658 2:143006523-143006545 GCCAGGAAGCTCAAACTGGGTGG + Intronic
939795754 2:146642292-146642314 GCCAGGAAGCTCAAACTGGGAGG + Intergenic
940573648 2:155472141-155472163 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
941399687 2:165015241-165015263 GCCAGCACGCAGACCCTGACTGG + Intergenic
941410955 2:165156560-165156582 GCCAGAAAACAGACAAAGAGTGG + Intronic
941548824 2:166889115-166889137 GCCAGGAGGCAGCTGCTGAGGGG - Intronic
941896108 2:170630391-170630413 GCCAGGAAGCTCGAACTGAGTGG + Intronic
942091246 2:172493576-172493598 ACAAGGAAGCAGACTCAGAGAGG + Intronic
942110286 2:172675128-172675150 GACAAGAAGCAGCCAGTGAGTGG - Intergenic
942253846 2:174071956-174071978 GCGAGGAAACAGATTCTGAGTGG + Intergenic
942684179 2:178513282-178513304 GCCAGGATCCTGACACTGGGAGG - Exonic
942742536 2:179196424-179196446 GCCAGGAAGCTCAAACTGGGTGG + Intronic
942792466 2:179776257-179776279 GGCAGGAAATGGACACTGAGAGG + Intronic
943866500 2:192930812-192930834 GCCAGGAAGCTCGAACTGAGTGG - Intergenic
943987269 2:194639239-194639261 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
944281333 2:197901636-197901658 GAGAGGAAGCAGAGACCGAGAGG + Intronic
944366785 2:198930307-198930329 GGCAGGAAGCAGACATTAATTGG - Intergenic
944612989 2:201430473-201430495 GCCGGGAAGCTCAAACTGAGTGG - Intronic
945987790 2:216369567-216369589 ACCAGGAACCAGACACTCATTGG + Intronic
947585751 2:231355616-231355638 GCCAGGAGGCTGACCCTGTGAGG - Intronic
948356415 2:237381330-237381352 CCCAGTATGCAGACACTGTGAGG - Exonic
948359768 2:237412020-237412042 GCCAGGAAGCAGACACTGAGTGG - Intronic
948519537 2:238526855-238526877 TGCAGGGAGCAGACACTGGGGGG - Intergenic
948669032 2:239554874-239554896 CTCAGGAAGCAGCCTCTGAGAGG + Intergenic
1168882289 20:1217229-1217251 GCCAGGAAGCTTGAACTGAGTGG + Intergenic
1169098105 20:2921664-2921686 TACAGGAAGCAGACACAGATGGG + Intronic
1169210125 20:3761274-3761296 GACAGGAAGCAGATACTCACAGG + Intronic
1170420332 20:16186258-16186280 GCCAGGAAGGAGGCACGGACAGG + Intergenic
1170494600 20:16913073-16913095 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1170517741 20:17149245-17149267 CCCCAGAAGCAGACATTGAGAGG + Intergenic
1170969037 20:21101703-21101725 TCCAGGAGGCAGGCACTGGGCGG - Intergenic
1171056932 20:21916379-21916401 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1171466351 20:25330431-25330453 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1171733197 20:28737131-28737153 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1171748339 20:29022422-29022444 GCCAGGAAGCAGGAACTGGGTGG + Intergenic
1172129877 20:32648383-32648405 GCCATGAAGCAAACAATCAGGGG - Intergenic
1172885975 20:38231122-38231144 GCCCTGGACCAGACACTGAGTGG - Intronic
1173004029 20:39126054-39126076 CCCCAGAAGCAGACCCTGAGAGG - Intergenic
1173386446 20:42592739-42592761 ACCAGGAAGCAGAAACTGACAGG - Intronic
1173474433 20:43349035-43349057 GCCAGGAATCAGGCATTGTGGGG - Intergenic
1174291602 20:49512927-49512949 GTGAGGAAGCAAACACAGAGAGG + Intronic
1174642126 20:52053800-52053822 GCTAAGTAGCAGACACTGAGGGG + Intronic
1174714027 20:52737735-52737757 ACCAGGAAGCAGGAACTCAGAGG - Intergenic
1175010123 20:55726387-55726409 GACAGGGAGAGGACACTGAGGGG + Intergenic
1175996328 20:62813727-62813749 GTCACGAAGCAGAGCCTGAGGGG - Exonic
1176124746 20:63470481-63470503 GACAGGAAGGAGAGACAGAGGGG + Intronic
1176317168 21:5257198-5257220 GCCAGGAAGCGGGAACTGGGTGG - Intergenic
1178458287 21:32776543-32776565 ACCAGGAAGCAGACCCTCACCGG - Intergenic
1179113996 21:38473005-38473027 GGCAGGCAGCAGGCACTGCGGGG + Intronic
1179578076 21:42320135-42320157 ACCAGGAAGCAGAGCCTGAGAGG + Intergenic
1180377819 22:12111463-12111485 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1180394965 22:12323128-12323150 GCCAGGAAGCGGGAACTGGGTGG - Intergenic
1180404775 22:12541620-12541642 GCCAGGAAGCGGGAACTGGGTGG + Intergenic
1180972704 22:19823618-19823640 TCCAGGAAGCAGAGCCTGACAGG + Intronic
1180981931 22:19882598-19882620 CCCAGGACGCAGACACTGACAGG + Intronic
1181032716 22:20156123-20156145 GCCAGGAAACAGGCCCTGAATGG + Intergenic
1181394475 22:22609710-22609732 CCCTGGAATCAGACTCTGAGAGG - Intergenic
1181510712 22:23387484-23387506 GCCAGGGAACAGGCCCTGAGTGG - Intergenic
1182057786 22:27373517-27373539 GCCAGGAAGCTCAAACTGGGCGG + Intergenic
1182105592 22:27686759-27686781 GCCAGGCAGCAGACAGTGGGAGG + Intergenic
1182157030 22:28084008-28084030 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1182522621 22:30892886-30892908 CCCAGGAGCCAGGCACTGAGAGG + Intronic
1183654855 22:39178764-39178786 TCCAGTTAGCAAACACTGAGTGG + Intergenic
1184037963 22:41927359-41927381 GCCAGGACACAGACCCTGAGTGG + Intergenic
1184843637 22:47067286-47067308 GCCTGGAAGAAGAGACAGAGTGG - Intronic
1185017125 22:48351364-48351386 GCCAGGCAGAGGACACTGTGAGG + Intergenic
1185148147 22:49150291-49150313 GGCAGGAACCAGACACTCAAGGG - Intergenic
1185369441 22:50454293-50454315 GTCTGGAAGCACCCACTGAGTGG + Intronic
949440164 3:4071684-4071706 GCCAGGAAGCTCAAACTGGGTGG + Intronic
949517744 3:4822257-4822279 GCCAGGAAGCAGGGGCTGCGGGG + Intronic
949879391 3:8649672-8649694 GCAAGGAAGCAGACTGGGAGAGG - Intronic
950447182 3:13045089-13045111 GCCAGGAGGCAGATGCTAAGTGG - Intronic
950835183 3:15912878-15912900 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
951401686 3:22240380-22240402 GGCAGGAAGAAGATAGTGAGAGG - Intronic
951497783 3:23349725-23349747 GCCAGGAAGCTCAAACTGGGTGG + Intronic
952118750 3:30216013-30216035 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
952278613 3:31902107-31902129 GACCGGAAACAGGCACTGAGAGG - Intronic
952544196 3:34400807-34400829 GCCAGGAAGCAGACACCTATTGG - Intergenic
953643201 3:44728799-44728821 GTGAGGAAGCAGGCACAGAGAGG + Intergenic
953821991 3:46214823-46214845 AGCAGAAAGCAGACACTGGGGGG + Intronic
953916770 3:46925419-46925441 GCCAGGAAGCAGAGGTGGAGAGG + Intronic
954214041 3:49114584-49114606 GTCAGGAAGCCTACCCTGAGTGG + Intronic
954500972 3:51013824-51013846 GCCAGGAAGCTCAAACTGGGTGG - Intronic
954713042 3:52514360-52514382 TCCAGGACGCAGACACAGTGCGG + Exonic
954808072 3:53231750-53231772 ACCAGGCAGTAGACAGTGAGTGG - Intronic
954836485 3:53473599-53473621 GCCAGGAAGCTTGAACTGAGTGG - Intergenic
956589463 3:70898454-70898476 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
956885980 3:73560330-73560352 GCCAGGAAAGAGAGAGTGAGCGG + Intronic
958918066 3:100071772-100071794 GGCAGGAAGAAGACAATAAGAGG - Intronic
959736491 3:109665202-109665224 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
959866514 3:111276542-111276564 GAGAGGAAGCAGACTGTGAGAGG - Intergenic
959940136 3:112072622-112072644 GCCAGGAAGCTCAAACTGGGTGG - Intronic
960792906 3:121452729-121452751 GCCAGGAAGCTCAAACTGAGTGG + Intronic
960859051 3:122132810-122132832 CCTAGGAAGCAGACAGTAAGTGG + Intergenic
961244700 3:125441033-125441055 GTCAGGAAGGAGAGACTGAAAGG - Intergenic
961381577 3:126499264-126499286 CCCAGGACGCAGACCCTGAACGG + Intronic
961493290 3:127271702-127271724 GCCAAGAAGCTGACACAGGGTGG - Intergenic
962191150 3:133312384-133312406 GCCAGGAAGCTCAAACTGGGTGG - Intronic
962608095 3:137049609-137049631 GCCCAGAAGCAGATCCTGAGAGG + Intergenic
962891558 3:139677340-139677362 GCCCAGCAGCGGACACTGAGTGG + Intronic
963050715 3:141140974-141140996 GCCAGGAAGCTCAAACTGGGTGG - Intronic
963159959 3:142141020-142141042 GCCAGGAAGCTCAAACTGGGCGG - Intronic
963978499 3:151509972-151509994 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
963991396 3:151660054-151660076 GACCAGAAACAGACACTGAGTGG + Intergenic
964318549 3:155469543-155469565 GCCAGGAAGCTCAAACTGGGTGG + Intronic
964492237 3:157249232-157249254 GCCAGGAGGCAGTCCTTGAGGGG + Intergenic
964500234 3:157340521-157340543 GCCAGGAAGCTCAAACTGGGTGG + Intronic
964564483 3:158034626-158034648 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
965194150 3:165572811-165572833 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
965439041 3:168690834-168690856 GCAATGGAGCAGAGACTGAGTGG + Intergenic
965662426 3:171055872-171055894 GCAATGAAGCAGAAAATGAGTGG + Intergenic
967906741 3:194507760-194507782 GCCAGGACGCAGGCCCTAAGGGG - Intergenic
968940400 4:3634637-3634659 CTCAGGAAGCAGATGCTGAGCGG - Intergenic
969159836 4:5247217-5247239 GCCAGGAAGCTCAAACTGGGTGG - Intronic
970972159 4:21997124-21997146 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
972267351 4:37474455-37474477 GCCAGGTAGTAGGCACTGAGGGG - Intronic
972270217 4:37503249-37503271 GCCAGGAAGGAGTCACAGTGAGG + Intronic
972373453 4:38448436-38448458 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
972416713 4:38847780-38847802 GCCAGGAAGCTCAAACTGGGTGG + Intronic
972434023 4:39014354-39014376 GGCAGGTAGAAGACATTGAGGGG + Intronic
973111727 4:46405154-46405176 GCCAGGAAGCTGGAACTGGGCGG + Intronic
973124554 4:46567595-46567617 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
973986925 4:56363220-56363242 GCCAGGAAGCTCAAACTGGGTGG + Intronic
974311929 4:60223578-60223600 ATAAGGAAACAGACACTGAGAGG - Intergenic
974547694 4:63334082-63334104 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
975138260 4:70895329-70895351 ACCAGAAAGCATCCACTGAGTGG - Intergenic
975211561 4:71706572-71706594 GCAAGGAAGCTGACTCAGAGAGG - Intergenic
975729838 4:77327262-77327284 GCCAGGAAGCTCAAACTGGGTGG - Intronic
976063168 4:81154237-81154259 GCCAGGAAGCTCAAACTGGGTGG + Intronic
976574758 4:86656869-86656891 GCCAGGAAGCTCGAACTGAGTGG - Intronic
976658683 4:87516604-87516626 GTCAGGAAGCACTCACTGAATGG - Intronic
976876210 4:89856613-89856635 GCCAGGAAGCCCAAACTGGGGGG + Intergenic
976941335 4:90705617-90705639 GCCAGGAAGCTCAAACTGGGTGG - Intronic
977288630 4:95139559-95139581 GCCAGGAAGCTCAAACTGGGTGG - Intronic
977497907 4:97800826-97800848 GCCAGGAAGCTCAAACTGGGTGG - Intronic
977534262 4:98238530-98238552 GCAAGGAAGCAGGCACTGTGCGG + Intergenic
978060139 4:104327129-104327151 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
978187291 4:105871683-105871705 CCCAAGAAGCTGACACTGGGAGG + Intronic
978197123 4:105984707-105984729 GCCAGGAAGCGCAAACTGGGTGG - Intronic
978205294 4:106073766-106073788 GCCAGGAAGCTCAAACTGGGTGG - Intronic
979516600 4:121616690-121616712 GCCTGGAAGCTCGCACTGAGCGG + Intergenic
979659587 4:123238168-123238190 GCCAGGAAGCTCAAACTGGGTGG + Intronic
979757638 4:124361706-124361728 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
980139288 4:128896034-128896056 GCCAGGAAGCTCAAACTGGGTGG + Intronic
980659841 4:135842874-135842896 GCCAGGAAGCATAAACTCATGGG - Intergenic
981046605 4:140270606-140270628 GCCAGGTAGCAGGCAATGAGGGG - Intronic
981441819 4:144792077-144792099 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
981531896 4:145761690-145761712 GCCAGGCCTCAGACACTGGGGGG - Intronic
981869426 4:149468473-149468495 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
982356622 4:154476717-154476739 GCAGGGAAGCAGATACTAAGTGG + Intronic
982619952 4:157691979-157692001 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
982836513 4:160125733-160125755 GCCAGGAAGCAGGAACTGGGTGG - Intergenic
982883297 4:160746830-160746852 GCCAGGAAGCTCAAACTGGGCGG + Intergenic
983066163 4:163212465-163212487 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
983207356 4:164924633-164924655 GCCATCAAGCAGACACTAAGAGG - Intergenic
983573616 4:169236545-169236567 GTGAGGAAGCAGACATAGAGAGG - Intronic
983949076 4:173618887-173618909 GCCAGGAAGCTCAAACTGGGCGG - Intergenic
984434015 4:179685335-179685357 ACCAGGAAGCTCAAACTGAGTGG - Intergenic
984880699 4:184407776-184407798 GCCAGGAAGCAGTTGCTGAGAGG + Intronic
985485741 5:147124-147146 GTCAGGAAGGAGTCACTGGGAGG + Intronic
985645731 5:1083942-1083964 CCCAGGAGGCAGACCCTGGGCGG + Exonic
985978222 5:3439389-3439411 GCCGGGAAGCTCAAACTGAGTGG + Intergenic
986127073 5:4893224-4893246 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
986596077 5:9423738-9423760 GCAGGGAATCACACACTGAGTGG + Intronic
986656351 5:10016677-10016699 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
986877195 5:12126122-12126144 GCCAGGAAGCCCAAACTGGGTGG + Intergenic
987179921 5:15356558-15356580 GCCAGGAAGCCCAAACTGGGTGG + Intergenic
987317794 5:16740284-16740306 ACCAGAAAGCACACATTGAGGGG + Intronic
987482103 5:18472298-18472320 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
987949791 5:24660396-24660418 GCCAGGAAGCTCGAACTGAGTGG - Intergenic
987980952 5:25083183-25083205 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
988606150 5:32680009-32680031 TCCAGGAAACATACTCTGAGAGG - Intergenic
988840165 5:35075534-35075556 GCCAGGAAGCTGGAACTGGGTGG + Intronic
988917754 5:35912207-35912229 GCCAGGAAGCTCAAACTGGGTGG + Intronic
989237014 5:39159758-39159780 ACAAGGAAGCAGGCACTGATGGG - Intronic
989449495 5:41570184-41570206 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
989614726 5:43328526-43328548 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
989949496 5:50280699-50280721 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
989968182 5:50489635-50489657 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
990152661 5:52837320-52837342 GTCTGGAAGGAGACACTGTGTGG - Intronic
990360422 5:55013336-55013358 GCCAGGAAGCTCAAACTGGGTGG + Intronic
990450676 5:55929415-55929437 ATCAGGAAGGAGACCCTGAGAGG - Intergenic
990492935 5:56319854-56319876 GCCAGGAAGCTGCCCCTCAGGGG - Intergenic
990599523 5:57343528-57343550 ATGAGGAAGCAGACAGTGAGGGG - Intergenic
990838590 5:60049890-60049912 GCCAGGAAGCTCAAACTGGGTGG - Intronic
990842943 5:60104352-60104374 GCCAGGAAGCTCAAACTGGGTGG + Intronic
991213526 5:64134622-64134644 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
992183630 5:74222453-74222475 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
993497407 5:88623121-88623143 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
993676511 5:90821940-90821962 GCCAGGAAGCTCAAACTGGGTGG - Intronic
994160908 5:96555722-96555744 GCCAGGAAGCTCAAACTGGGTGG + Intronic
994352413 5:98762428-98762450 TCCAGGAACCAGACACCAAGTGG + Intergenic
995329865 5:110934463-110934485 GCCAGGAAGCTCGAACTGAGTGG + Intergenic
995337500 5:111017115-111017137 ACCAGGAAGCAGACAAAGATAGG - Intergenic
995719722 5:115117758-115117780 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
996158509 5:120132525-120132547 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
996420415 5:123256562-123256584 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
996504421 5:124253356-124253378 GCAGGGAAGGAAACACTGAGTGG + Intergenic
998465534 5:142341069-142341091 GACAAGAAGCAGAAACTGAGAGG + Intergenic
998934213 5:147216748-147216770 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
999283410 5:150379680-150379702 GCGAGGAATCAGACAGTGATGGG + Exonic
999605132 5:153306084-153306106 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1000414582 5:160970124-160970146 TCCGGGAAACAGACTCTGAGAGG - Intergenic
1000499998 5:162036450-162036472 GCCAGGAAGCGGGAACTGGGTGG - Intergenic
1001212188 5:169820117-169820139 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1001577623 5:172774390-172774412 GTCACCAAGCAGACAGTGAGCGG - Intergenic
1002010159 5:176272931-176272953 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1002278053 5:178115771-178115793 GCCAGGAAGCAAAGAAGGAGAGG - Intronic
1002284244 5:178151709-178151731 GCCAGGAAGAAGGTCCTGAGAGG - Intronic
1002302881 5:178267485-178267507 ACGAGGAAGCAGACACAGTGAGG + Intronic
1002788632 6:423224-423246 GCCAGGCAGCTCACGCTGAGAGG - Intergenic
1003732211 6:8837547-8837569 TCAAGGAGGCTGACACTGAGGGG + Intergenic
1004135058 6:12957974-12957996 GCCAGGAAACAGACCCAGAGAGG + Intronic
1004347001 6:14857763-14857785 TGCAGGAAGTTGACACTGAGGGG - Intergenic
1006000425 6:30960623-30960645 TCCAGGTAGCAGACACAGATAGG + Intergenic
1006855739 6:37131949-37131971 GTCAGGAAGCAGGCTCAGAGAGG - Intergenic
1007816766 6:44530514-44530536 CCTGGGAAGCAGACTCTGAGAGG + Intergenic
1007824489 6:44589810-44589832 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1007977882 6:46119929-46119951 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1007988359 6:46230420-46230442 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1008163145 6:48102950-48102972 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1008596152 6:53043969-53043991 TCCAAGAAGCAGAAACTAAGAGG + Intronic
1008968114 6:57335329-57335351 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1009282446 6:61769682-61769704 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1009384842 6:63075944-63075966 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1009410587 6:63361300-63361322 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1009476415 6:64097397-64097419 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1009613028 6:65971481-65971503 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1009695324 6:67095892-67095914 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1009912645 6:69951484-69951506 GCCAAGAAGCAAACACTTGGGGG + Intronic
1009917167 6:70010827-70010849 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1010137319 6:72570618-72570640 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1010364262 6:75031316-75031338 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1010422123 6:75688047-75688069 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1010526442 6:76905726-76905748 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1011139105 6:84133509-84133531 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1011245155 6:85314641-85314663 GCCAGGAAGCTCAAACTGGGCGG - Intergenic
1012285418 6:97382203-97382225 GCCAGGAAGCACGAACTGGGTGG - Intergenic
1012608624 6:101188618-101188640 GCCAGGAAGCTGGAACTGTGTGG + Intergenic
1012719405 6:102722585-102722607 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1012776225 6:103496689-103496711 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
1013323094 6:109014717-109014739 GCCCAGAAAGAGACACTGAGAGG - Intronic
1013926635 6:115480732-115480754 GCCAGGAAGCTCAGACTGGGTGG - Intergenic
1013967465 6:115972099-115972121 CCCAGGAAACAGAAGCTGAGAGG - Intronic
1014289292 6:119539772-119539794 GCGAGGAAGTACACACTGATTGG - Intergenic
1014669647 6:124285522-124285544 GGCAGCAAGGAGACTCTGAGTGG - Intronic
1014881238 6:126726744-126726766 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1015653362 6:135488876-135488898 ACCAGGATTCAAACACTGAGTGG - Intronic
1015699749 6:136022873-136022895 GCCAGGAAGCACTGGCTGAGAGG + Intronic
1016523858 6:144977375-144977397 ACCGGGAAGCAGAAACTGGGTGG - Intergenic
1017659033 6:156656025-156656047 GACAGAAAGCAGAAACAGAGAGG - Intergenic
1018315246 6:162550259-162550281 TCCTAGAAGCAGACACTAAGTGG + Intronic
1019143149 6:169960941-169960963 GCCAGGCAGCAGACACTGTGGGG + Intergenic
1019801560 7:3091781-3091803 CCCAGGAAGCAGACTCAGAGAGG - Intergenic
1020456359 7:8377731-8377753 GACACGAAGCAGACAGTGATTGG - Intergenic
1020948682 7:14648112-14648134 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1021307201 7:19046206-19046228 GCCAGGAAGCTCGAACTGAGTGG + Intronic
1021538123 7:21727850-21727872 TCCAAGATGGAGACACTGAGGGG + Intronic
1021655607 7:22870693-22870715 GCCAGGAAGATGACACTGAAAGG + Intergenic
1022933923 7:35152299-35152321 GCCAGGAAGCACGAACTGGGTGG + Intergenic
1023022094 7:36019627-36019649 GCCAGGAAGCAGACCAGGAGCGG - Intergenic
1023153248 7:37222191-37222213 ATCAGGAAACAGACCCTGAGGGG - Intronic
1024254295 7:47528298-47528320 GCAGGGAAGGAGGCACTGAGGGG + Intronic
1025869234 7:65415269-65415291 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1025957874 7:66196565-66196587 TCCAGGAAGGAGAGGCTGAGTGG - Intergenic
1027982993 7:85250337-85250359 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1028050079 7:86174410-86174432 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1028177576 7:87675201-87675223 GGGAGGAAGCAGACACTGGGTGG - Intronic
1028436181 7:90806964-90806986 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1028446418 7:90928867-90928889 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1028489458 7:91395005-91395027 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1028826646 7:95281340-95281362 GCCAGGCAGAAGGCAATGAGAGG - Intronic
1029207945 7:98880056-98880078 GCCAGGCAGCAGGCACTCAGTGG - Intronic
1029810078 7:103038303-103038325 GCCAGGAAGCACAAACTGGGCGG + Intronic
1030449691 7:109692783-109692805 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1030510061 7:110472702-110472724 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1031284921 7:119855290-119855312 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1032529810 7:132610766-132610788 TCCAGGAGGCAGAAACTGGGAGG - Intronic
1033293443 7:140108915-140108937 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1033504374 7:141985611-141985633 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1033960385 7:146906269-146906291 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1033962229 7:146928928-146928950 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1034300808 7:150013835-150013857 ACCAGGAACCAGAGACTCAGAGG + Intergenic
1034369229 7:150580118-150580140 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1034391230 7:150789113-150789135 GCAAAGTAGCAGACACTCAGGGG - Intergenic
1034544813 7:151782790-151782812 GCCAGGAAGCACACGGTGCGTGG + Intronic
1034583322 7:152066082-152066104 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1034676874 7:152898317-152898339 TCCAGGAAGCCAACTCTGAGTGG - Intergenic
1034761231 7:153673860-153673882 GCCAGGAAGCATGTTCTGAGTGG + Intergenic
1034805243 7:154083465-154083487 ACCAGGAACCAGAGACTCAGAGG - Intronic
1035583037 8:752235-752257 GCCATGAAGCAGAGAGGGAGAGG + Intergenic
1035636947 8:1154870-1154892 TCCAGGTAGCAGACACTGGAGGG - Intergenic
1035715846 8:1754193-1754215 GCCAGGAAACAGACACTTGCAGG - Intergenic
1036189914 8:6660834-6660856 GACACGAATCAGACACTGACTGG + Intergenic
1036745695 8:11407618-11407640 GCCAGAAAGCTGAAACTGGGTGG - Intronic
1036754181 8:11461465-11461487 GGCAGAAAGTAGACACAGAGTGG + Intronic
1037082461 8:14803696-14803718 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1038226200 8:25660448-25660470 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1038655735 8:29449686-29449708 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1039088436 8:33802729-33802751 GCCAGGAAGTAGAGAGTCAGAGG - Intergenic
1039291241 8:36096290-36096312 GCTGGGCAGCAGAAACTGAGAGG + Intergenic
1039317951 8:36394106-36394128 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1039347714 8:36726227-36726249 GCCAGGAAGCACAAACTGGGTGG + Intergenic
1039403760 8:37295260-37295282 GCCAGTGAGCAGCCACTCAGAGG + Intergenic
1040328520 8:46374424-46374446 GCAGGAAAGCAGAAACTGAGGGG - Intergenic
1040341349 8:46442719-46442741 GGCAGGGAGCAGACACTCAGGGG - Intergenic
1040373279 8:46797808-46797830 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1040390144 8:46942641-46942663 GCCAGGAAGCTCAAACTGAGTGG + Intergenic
1040749910 8:50692895-50692917 GCCAGGAAGCTGGAACTGGGTGG - Intronic
1040756610 8:50783346-50783368 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1040962417 8:53048789-53048811 GCCAGGAAGCTCTCACCGAGTGG - Intergenic
1041017971 8:53609986-53610008 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1041027363 8:53700800-53700822 GCCAGGAAGCTCGAACTGAGTGG - Intergenic
1041637559 8:60160845-60160867 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1042024224 8:64405552-64405574 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1042026314 8:64427735-64427757 GCCAGAAATCAGAAACAGAGGGG + Intergenic
1042059924 8:64805457-64805479 CCCAGGAAACAGACTCTGAGAGG + Intergenic
1042089394 8:65142330-65142352 GACAAAATGCAGACACTGAGAGG + Intergenic
1042457226 8:69019485-69019507 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1042698269 8:71582100-71582122 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1042710150 8:71708356-71708378 GCCAGGAAGGACACACTGCAGGG - Intergenic
1042800555 8:72713157-72713179 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1044183007 8:89218664-89218686 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1044411775 8:91891830-91891852 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1044590130 8:93906373-93906395 GCCCTAAAGCAGACACTGTGTGG + Intronic
1044601440 8:94009266-94009288 GCCAGGAAGCTGGAACTGGGTGG - Intergenic
1044630558 8:94274276-94274298 GGCAAGAAGCAGACATGGAGAGG - Intergenic
1045799964 8:106090651-106090673 GCCAGGAATCAAACCCTGGGAGG + Intergenic
1046007687 8:108505941-108505963 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1046235475 8:111418940-111418962 CCCAGAAAGCACAAACTGAGAGG - Intergenic
1046467682 8:114627894-114627916 GGCAGGTAGCAGACACAGTGTGG + Intergenic
1046554053 8:115753643-115753665 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1046812616 8:118549019-118549041 GCCAGGAAGCTGGAACTGGGTGG + Intronic
1047060135 8:121215973-121215995 CCCAGGGAGTAGACTCTGAGGGG - Intergenic
1047495082 8:125403553-125403575 GCCAGGAAGCTGCCCCTAAGGGG + Intergenic
1048796401 8:138153783-138153805 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1049671463 8:143871964-143871986 GCCTGGATGAAGACACTCAGCGG - Exonic
1049741534 8:144243262-144243284 GCCACAGAGCAGACACTGTGTGG - Intronic
1049747225 8:144268159-144268181 GCCAGGAGGCAGACGCTGCTGGG + Exonic
1049779835 8:144423905-144423927 CCCAGGCTGCAGACCCTGAGCGG - Exonic
1049944936 9:585124-585146 ACATGGAAGAAGACACTGAGTGG - Intronic
1050151013 9:2619684-2619706 GCCAAAAGGCAGACACAGAGAGG + Intergenic
1050178978 9:2899727-2899749 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1050381177 9:5032245-5032267 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1050407703 9:5327394-5327416 GCTAGGAAGCACAAACTGGGTGG + Intergenic
1051176730 9:14368273-14368295 GCCAAGAAGCAGACATAAAGAGG + Intronic
1051579291 9:18653347-18653369 GTCAGGAAGGAGATACTGAGTGG - Intronic
1051612414 9:18974077-18974099 CCAAGGAAGCAGACAGTAAGGGG + Intronic
1052115449 9:24644395-24644417 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1052117656 9:24668514-24668536 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1052239102 9:26250252-26250274 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1052352197 9:27469399-27469421 GCCAGGATGCTGTCACTGAAGGG - Intronic
1052628079 9:31002940-31002962 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1053718014 9:40916266-40916288 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1055332552 9:75199009-75199031 GGCAAGAAGAACACACTGAGTGG - Intergenic
1055642941 9:78334800-78334822 GCCAGGAAGCTCAAACTGGGCGG + Intergenic
1057199147 9:93131167-93131189 CCCAGGAAGCAGGCCCTGAGAGG + Intronic
1058086005 9:100749110-100749132 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1060666113 9:125433125-125433147 GGCACAAAGCAGACAGTGAGAGG + Intergenic
1062043890 9:134416431-134416453 CCCAGGAAGCAGCCACTCGGGGG - Intronic
1062294500 9:135817031-135817053 CACAGGAAGCCGATACTGAGAGG + Intronic
1062303624 9:135889677-135889699 GCCAGGAGGCAGACACTAAGGGG + Intronic
1203761174 EBV:13469-13491 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203762103 EBV:16541-16563 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203763032 EBV:19613-19635 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203763961 EBV:22685-22707 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203764890 EBV:25757-25779 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203765819 EBV:28829-28851 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203766748 EBV:31901-31923 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203767677 EBV:34973-34995 GCCTGGAGGCAGAGACTGGGCGG - Intergenic
1203410432 Un_KI270581v1:3535-3557 GCCAGGAAGCGGGAACTGGGTGG + Intergenic
1203415432 Un_KI270582v1:2246-2268 GCCAGGAAGCGGGAACTGGGTGG - Intergenic
1203540208 Un_KI270743v1:81819-81841 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1186215228 X:7292897-7292919 GTCAGGAAGCATGCACTGAAAGG - Intronic
1186461850 X:9754309-9754331 GCCAGGAACCAGTCACAGTGTGG - Intronic
1186563582 X:10638502-10638524 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1186720351 X:12297070-12297092 GTCAGTAAGCAGACACTGAAGGG - Intronic
1187116816 X:16360557-16360579 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1187118314 X:16376279-16376301 GGCTGCAAGCAGACACTCAGGGG - Intergenic
1188002306 X:24994437-24994459 GTCAGGAAGGAAACACGGAGGGG - Intronic
1189045609 X:37587440-37587462 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1189221573 X:39376625-39376647 GCCAGCAATAAGACACTGGGAGG - Intergenic
1189524853 X:41809086-41809108 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1190590637 X:51996919-51996941 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1190606703 X:52150778-52150800 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1190607548 X:52160403-52160425 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1190691504 X:52916638-52916660 ACCAGGAACCAGACCCAGAGAGG - Intergenic
1190694479 X:52939154-52939176 ACCAGGAACCAGACCCAGAGAGG + Intronic
1191063206 X:56320139-56320161 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1191157961 X:57295949-57295971 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1191196656 X:57731014-57731036 GCCAGGAAGCTCGCACTGGGTGG - Intergenic
1191592838 X:62906619-62906641 GCCAGGAAGCTCATACTGGGTGG - Intergenic
1191628211 X:63291576-63291598 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1192130343 X:68543744-68543766 ACAAGGAAGCAGAGACTCAGAGG + Intergenic
1192335469 X:70216037-70216059 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1192685932 X:73305227-73305249 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1192802521 X:74480127-74480149 GCCAGGAAGCTCAAACTGGGTGG - Intronic
1193033527 X:76924841-76924863 GCCAGGAAGCTTAAACTGGGTGG + Intergenic
1193157464 X:78189332-78189354 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1193640990 X:84009289-84009311 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1193840294 X:86401023-86401045 GCCAGGAAGCTCAAACTGTGTGG - Intronic
1194629824 X:96269868-96269890 GCCAGGAAGCCGGAACTGGGTGG + Intergenic
1194655838 X:96572089-96572111 GCCATAAAGCAGGGACTGAGTGG - Intergenic
1194879602 X:99235096-99235118 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1195835834 X:109113787-109113809 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1195916347 X:109939962-109939984 CCCAGGAAGCAAACTCTCAGAGG - Intergenic
1196901750 X:120390717-120390739 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1197746992 X:129938275-129938297 GGCAGGAAGCAGACAGCGGGAGG - Intergenic
1197959646 X:131989944-131989966 GCCAGGAAGCTTGAACTGAGTGG + Intergenic
1197988239 X:132290123-132290145 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1198123785 X:133621648-133621670 GCCAGGAAGCTCAAACTGGGTGG + Intronic
1198172162 X:134117662-134117684 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1198335786 X:135665188-135665210 GCCAGGAAGCTCAGACTGGGAGG - Intergenic
1198584532 X:138105752-138105774 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1199383794 X:147200764-147200786 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1199599481 X:149533435-149533457 TCCAGGAAGCAGACCATGAGAGG - Exonic
1199651150 X:149946772-149946794 TCCAGGAAGCAGACCATGAGAGG + Intergenic
1200226230 X:154419386-154419408 CCCAGCAAGCAGGGACTGAGGGG + Intronic
1200734033 Y:6774629-6774651 TCCAGGAAGCTCAAACTGAGAGG - Intergenic
1200737393 Y:6814320-6814342 GCCAGGAAGCTTAAACTGAGTGG + Intergenic
1200850871 Y:7881866-7881888 GCCATGAAGCTGACTATGAGAGG + Intergenic
1200879132 Y:8193952-8193974 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1200956199 Y:8948689-8948711 GCCAGGAAGCTCAAACTGTGTGG - Intergenic
1201148213 Y:11078223-11078245 GCCAGGAAGCAGTCCCTCACTGG + Intergenic
1201247077 Y:12015268-12015290 GCCAGGAAGCTCAAACTGGGTGG - Intergenic
1201308269 Y:12570054-12570076 GCCAGGAAGCTGGAACTGGGTGG + Intergenic
1201435319 Y:13952302-13952324 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1201566393 Y:15369185-15369207 GCCAGGAAGCTTGAACTGAGGGG + Intergenic
1201588732 Y:15590490-15590512 GCCAGGAAGTTCAAACTGAGTGG - Intergenic
1201684311 Y:16683687-16683709 GCCAGGAAGCTCAAACTGGGTGG + Intergenic
1202064635 Y:20925504-20925526 GCCAGGAAGCTCAAACTGGGTGG - Intergenic