ID: 948359770

View in Genome Browser
Species Human (GRCh38)
Location 2:237412041-237412063
Sequence GCTTCTCTCGACCATGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948359762_948359770 17 Left 948359762 2:237412001-237412023 CCTTCCCAAGCCCTCTGCTCCAC 0: 1
1: 0
2: 5
3: 57
4: 531
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359764_948359770 12 Left 948359764 2:237412006-237412028 CCAAGCCCTCTGCTCCACTCAGT 0: 1
1: 0
2: 2
3: 35
4: 371
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359761_948359770 30 Left 948359761 2:237411988-237412010 CCAACATGGAATTCCTTCCCAAG 0: 1
1: 0
2: 3
3: 21
4: 174
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359768_948359770 -2 Left 948359768 2:237412020-237412042 CCACTCAGTGTCTGCTTCCTGGC 0: 1
1: 0
2: 6
3: 55
4: 740
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359766_948359770 6 Left 948359766 2:237412012-237412034 CCTCTGCTCCACTCAGTGTCTGC 0: 1
1: 0
2: 2
3: 27
4: 292
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359763_948359770 13 Left 948359763 2:237412005-237412027 CCCAAGCCCTCTGCTCCACTCAG 0: 1
1: 0
2: 1
3: 27
4: 318
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
948359765_948359770 7 Left 948359765 2:237412011-237412033 CCCTCTGCTCCACTCAGTGTCTG 0: 1
1: 0
2: 1
3: 38
4: 309
Right 948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948359770 Original CRISPR GCTTCTCTCGACCATGAGTG AGG Intronic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG + Exonic
1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG + Intergenic
1077293546 11:1812891-1812913 GCTTCTTTAGACCATGGCTGGGG + Intergenic
1081586134 11:44385152-44385174 GCTTCTCCCCTCCATCAGTGAGG + Intergenic
1097589131 12:61552128-61552150 ACTTCCCTGGACCATGAGTCTGG - Intergenic
1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG + Intergenic
1104230354 12:126878441-126878463 GCTTCTCTAGACAATGGATGGGG - Intergenic
1106462028 13:29979411-29979433 GCTTCTCAGGACCATGACTTTGG - Intergenic
1114832263 14:26159164-26159186 GCTTCTCTTGACCATGCTTTTGG + Intergenic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1121782342 14:96629995-96630017 GCTGCTCTTGAACAGGAGTGAGG + Intergenic
1124582991 15:30978421-30978443 GGTTCTGTCCACCATGAGTTGGG + Intronic
1133218806 16:4309418-4309440 GCTTCTCCCTCCCATCAGTGTGG - Intergenic
1133643486 16:7740672-7740694 CCCTCTCTGGACCTTGAGTGAGG - Intergenic
1139480869 16:67229974-67229996 GCTGCTCTGGACCATGCCTGAGG + Exonic
1139675533 16:68520663-68520685 GCTTCTCTCTACCCTGAGCCTGG - Intergenic
1142525163 17:535059-535081 GCTTCTCTGGGCCATCAGGGCGG + Intronic
1147206645 17:38842070-38842092 CCTTCTCTCATCCAGGAGTGTGG - Intergenic
1153018597 18:606550-606572 GCTTCTCCTGACCAGGGGTGAGG - Intronic
1160057385 18:75496331-75496353 GCTCCTTTCAACCATGACTGTGG + Intergenic
926301268 2:11604837-11604859 GCTTCTTGCCACCATGTGTGTGG + Intronic
935874990 2:107496813-107496835 GCTTCTCTGTACCTTGACTGTGG - Intergenic
941074190 2:160988830-160988852 GCTTCTCCCACCCATGAGTAGGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG + Intergenic
1171436550 20:25129524-25129546 TCTTCTCCCGACCACAAGTGAGG + Intergenic
1173051420 20:39565780-39565802 GCTTACCTCCAGCATGAGTGAGG + Intergenic
1178232218 21:30799100-30799122 GCTTCTCTGGAGACTGAGTGAGG + Intergenic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
1180996707 22:19969459-19969481 GCCTCCCTGGCCCATGAGTGAGG + Exonic
1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG + Intronic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
958965952 3:100558421-100558443 GCATTTCCCGGCCATGAGTGTGG - Exonic
961032484 3:123618601-123618623 GCTTCTCTTCACCATGAATAGGG - Intronic
963111373 3:141691223-141691245 GTTTTTCTCTACCATGAGTCTGG + Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
971093365 4:23370976-23370998 CCCTCTCAGGACCATGAGTGGGG - Intergenic
976222845 4:82771918-82771940 GCTGCTTTTGATCATGAGTGTGG - Intronic
990882235 5:60552167-60552189 GCTTCTCTCATCTATGAATGAGG + Intergenic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG + Intergenic
1007986939 6:46216576-46216598 GCTTCTCTCAACCATCCCTGTGG - Intergenic
1008466976 6:51842242-51842264 GCATCTCTGCTCCATGAGTGGGG + Intronic
1021110308 7:16686414-16686436 GTTTCTCTAGACCTTGAGAGGGG - Intronic
1022225180 7:28355386-28355408 GATTCTCTCTACTATGACTGCGG - Intronic
1030937095 7:115598104-115598126 GATTCTTCCTACCATGAGTGTGG - Intergenic
1038383684 8:27120763-27120785 GGTTCTCTGGGCCATGAGAGTGG - Intergenic
1047818413 8:128490740-128490762 GCTTCTCTAGGCCATGCGTGTGG + Intergenic
1048459818 8:134612197-134612219 GCCTTTCTCAGCCATGAGTGTGG + Intronic
1061964309 9:134004502-134004524 GCTTCTCTCAAACACCAGTGGGG + Intergenic
1190466687 X:50731512-50731534 GATCCTCTCTTCCATGAGTGGGG - Intronic
1194606518 X:95985570-95985592 GCCTCTCTGGACACTGAGTGAGG - Intergenic
1197231074 X:124004248-124004270 TCTTCTCTGGACTATGAGTGGGG - Intronic