ID: 948362020

View in Genome Browser
Species Human (GRCh38)
Location 2:237428665-237428687
Sequence GAGCCCTGCACAAACTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362017_948362020 30 Left 948362017 2:237428612-237428634 CCAAGCTCACTGTTCTAATAAGT No data
Right 948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362020 Original CRISPR GAGCCCTGCACAAACTCCCA AGG Intergenic
No off target data available for this crispr