ID: 948362426

View in Genome Browser
Species Human (GRCh38)
Location 2:237432559-237432581
Sequence GAGGTCGGGTACACTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362426_948362431 30 Left 948362426 2:237432559-237432581 CCAGCAGGAGTGTACCCGACCTC No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362426 Original CRISPR GAGGTCGGGTACACTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr