ID: 948362427

View in Genome Browser
Species Human (GRCh38)
Location 2:237432573-237432595
Sequence CAAGTGATGACACGGAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362427_948362431 16 Left 948362427 2:237432573-237432595 CCCGACCTCCGTGTCATCACTTG No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362427 Original CRISPR CAAGTGATGACACGGAGGTC GGG (reversed) Intergenic
No off target data available for this crispr