ID: 948362428

View in Genome Browser
Species Human (GRCh38)
Location 2:237432574-237432596
Sequence ACAAGTGATGACACGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362428_948362431 15 Left 948362428 2:237432574-237432596 CCGACCTCCGTGTCATCACTTGT No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362428 Original CRISPR ACAAGTGATGACACGGAGGT CGG (reversed) Intergenic
No off target data available for this crispr