ID: 948362430

View in Genome Browser
Species Human (GRCh38)
Location 2:237432581-237432603
Sequence AGTGTGCACAAGTGATGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362430_948362431 8 Left 948362430 2:237432581-237432603 CCGTGTCATCACTTGTGCACACT No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362430 Original CRISPR AGTGTGCACAAGTGATGACA CGG (reversed) Intergenic
No off target data available for this crispr