ID: 948362431

View in Genome Browser
Species Human (GRCh38)
Location 2:237432612-237432634
Sequence ACCATGCACCTCTCGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948362427_948362431 16 Left 948362427 2:237432573-237432595 CCCGACCTCCGTGTCATCACTTG No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data
948362426_948362431 30 Left 948362426 2:237432559-237432581 CCAGCAGGAGTGTACCCGACCTC No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data
948362429_948362431 11 Left 948362429 2:237432578-237432600 CCTCCGTGTCATCACTTGTGCAC No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data
948362430_948362431 8 Left 948362430 2:237432581-237432603 CCGTGTCATCACTTGTGCACACT No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data
948362428_948362431 15 Left 948362428 2:237432574-237432596 CCGACCTCCGTGTCATCACTTGT No data
Right 948362431 2:237432612-237432634 ACCATGCACCTCTCGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948362431 Original CRISPR ACCATGCACCTCTCGCAGAC AGG Intergenic
No off target data available for this crispr