ID: 948364682

View in Genome Browser
Species Human (GRCh38)
Location 2:237447041-237447063
Sequence GAGGTGGGGTCTTTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948364682_948364696 22 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364682_948364698 24 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364698 2:237447088-237447110 AATTTCAACACAAGAATTTGGGG No data
948364682_948364690 -6 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364690 2:237447058-237447080 CACCTCCTATACCATCGCCTTGG No data
948364682_948364697 23 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364697 2:237447087-237447109 GAATTTCAACACAAGAATTTGGG No data
948364682_948364699 25 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364682_948364691 -5 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948364682 Original CRISPR GAGGTGGGGTCTTTGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr