ID: 948364691

View in Genome Browser
Species Human (GRCh38)
Location 2:237447059-237447081
Sequence ACCTCCTATACCATCGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948364679_948364691 10 Left 948364679 2:237447026-237447048 CCCTCATGACCTAATCCCCTTCC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364682_948364691 -5 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364683_948364691 -6 Left 948364683 2:237447042-237447064 CCCTTCCCAAAGACCCCACCTCC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364677_948364691 29 Left 948364677 2:237447007-237447029 CCCATTCATGAGGGTTCTGCCCT 0: 15
1: 93
2: 344
3: 978
4: 1814
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364680_948364691 9 Left 948364680 2:237447027-237447049 CCTCATGACCTAATCCCCTTCCC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364681_948364691 1 Left 948364681 2:237447035-237447057 CCTAATCCCCTTCCCAAAGACCC No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364684_948364691 -7 Left 948364684 2:237447043-237447065 CCTTCCCAAAGACCCCACCTCCT No data
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data
948364678_948364691 28 Left 948364678 2:237447008-237447030 CCATTCATGAGGGTTCTGCCCTC 0: 16
1: 126
2: 643
3: 1824
4: 3410
Right 948364691 2:237447059-237447081 ACCTCCTATACCATCGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948364691 Original CRISPR ACCTCCTATACCATCGCCTT GGG Intergenic
No off target data available for this crispr