ID: 948364696

View in Genome Browser
Species Human (GRCh38)
Location 2:237447086-237447108
Sequence AGAATTTCAACACAAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948364692_948364696 3 Left 948364692 2:237447060-237447082 CCTCCTATACCATCGCCTTGGGA No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364682_948364696 22 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364681_948364696 28 Left 948364681 2:237447035-237447057 CCTAATCCCCTTCCCAAAGACCC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364693_948364696 0 Left 948364693 2:237447063-237447085 CCTATACCATCGCCTTGGGAGTT No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364684_948364696 20 Left 948364684 2:237447043-237447065 CCTTCCCAAAGACCCCACCTCCT No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364683_948364696 21 Left 948364683 2:237447042-237447064 CCCTTCCCAAAGACCCCACCTCC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364689_948364696 6 Left 948364689 2:237447057-237447079 CCACCTCCTATACCATCGCCTTG No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364687_948364696 8 Left 948364687 2:237447055-237447077 CCCCACCTCCTATACCATCGCCT No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364694_948364696 -6 Left 948364694 2:237447069-237447091 CCATCGCCTTGGGAGTTAGAATT No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364685_948364696 16 Left 948364685 2:237447047-237447069 CCCAAAGACCCCACCTCCTATAC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364688_948364696 7 Left 948364688 2:237447056-237447078 CCCACCTCCTATACCATCGCCTT No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data
948364686_948364696 15 Left 948364686 2:237447048-237447070 CCAAAGACCCCACCTCCTATACC No data
Right 948364696 2:237447086-237447108 AGAATTTCAACACAAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948364696 Original CRISPR AGAATTTCAACACAAGAATT TGG Intergenic
No off target data available for this crispr