ID: 948364699

View in Genome Browser
Species Human (GRCh38)
Location 2:237447089-237447111
Sequence ATTTCAACACAAGAATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948364682_948364699 25 Left 948364682 2:237447041-237447063 CCCCTTCCCAAAGACCCCACCTC No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364688_948364699 10 Left 948364688 2:237447056-237447078 CCCACCTCCTATACCATCGCCTT No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364689_948364699 9 Left 948364689 2:237447057-237447079 CCACCTCCTATACCATCGCCTTG No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364695_948364699 -9 Left 948364695 2:237447075-237447097 CCTTGGGAGTTAGAATTTCAACA 0: 7
1: 60
2: 315
3: 588
4: 824
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364687_948364699 11 Left 948364687 2:237447055-237447077 CCCCACCTCCTATACCATCGCCT No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364683_948364699 24 Left 948364683 2:237447042-237447064 CCCTTCCCAAAGACCCCACCTCC No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364692_948364699 6 Left 948364692 2:237447060-237447082 CCTCCTATACCATCGCCTTGGGA No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364686_948364699 18 Left 948364686 2:237447048-237447070 CCAAAGACCCCACCTCCTATACC No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364693_948364699 3 Left 948364693 2:237447063-237447085 CCTATACCATCGCCTTGGGAGTT No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364685_948364699 19 Left 948364685 2:237447047-237447069 CCCAAAGACCCCACCTCCTATAC No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364694_948364699 -3 Left 948364694 2:237447069-237447091 CCATCGCCTTGGGAGTTAGAATT No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data
948364684_948364699 23 Left 948364684 2:237447043-237447065 CCTTCCCAAAGACCCCACCTCCT No data
Right 948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948364699 Original CRISPR ATTTCAACACAAGAATTTGG GGG Intergenic
No off target data available for this crispr