ID: 948365277

View in Genome Browser
Species Human (GRCh38)
Location 2:237450706-237450728
Sequence AGCCCGGCGCCTTGCACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365277_948365288 26 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365288 2:237450755-237450777 GGAGGTGGTGATGCCCAGCCAGG No data
948365277_948365290 30 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365277_948365289 29 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365289 2:237450758-237450780 GGTGGTGATGCCCAGCCAGGTGG No data
948365277_948365284 5 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365284 2:237450734-237450756 GCCTGGCACACAAGCTGCATGGG No data
948365277_948365286 8 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365286 2:237450737-237450759 TGGCACACAAGCTGCATGGGAGG No data
948365277_948365283 4 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365283 2:237450733-237450755 GGCCTGGCACACAAGCTGCATGG No data
948365277_948365287 11 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365287 2:237450740-237450762 CACACAAGCTGCATGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365277 Original CRISPR AGCCCGGCGCCTTGCACCAT TGG (reversed) Intergenic