ID: 948365280

View in Genome Browser
Species Human (GRCh38)
Location 2:237450722-237450744
Sequence GTGTGCCAGGCCGGGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365280_948365289 13 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365289 2:237450758-237450780 GGTGGTGATGCCCAGCCAGGTGG No data
948365280_948365291 19 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365280_948365287 -5 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365287 2:237450740-237450762 CACACAAGCTGCATGGGAGGTGG No data
948365280_948365286 -8 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365286 2:237450737-237450759 TGGCACACAAGCTGCATGGGAGG No data
948365280_948365290 14 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365280_948365288 10 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365288 2:237450755-237450777 GGAGGTGGTGATGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365280 Original CRISPR GTGTGCCAGGCCGGGCAGCC CGG (reversed) Intergenic