ID: 948365281

View in Genome Browser
Species Human (GRCh38)
Location 2:237450730-237450752
Sequence TGCAGCTTGTGTGCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365281_948365295 26 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365295 2:237450779-237450801 GGGCACGGACCTCCCCACCCTGG No data
948365281_948365291 11 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365281_948365288 2 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365288 2:237450755-237450777 GGAGGTGGTGATGCCCAGCCAGG No data
948365281_948365290 6 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365281_948365289 5 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365289 2:237450758-237450780 GGTGGTGATGCCCAGCCAGGTGG No data
948365281_948365296 27 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365296 2:237450780-237450802 GGCACGGACCTCCCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365281 Original CRISPR TGCAGCTTGTGTGCCAGGCC GGG (reversed) Intergenic