ID: 948365285

View in Genome Browser
Species Human (GRCh38)
Location 2:237450735-237450757
Sequence TCCCATGCAGCTTGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365285_948365290 1 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365285_948365291 6 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365285_948365288 -3 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365288 2:237450755-237450777 GGAGGTGGTGATGCCCAGCCAGG No data
948365285_948365289 0 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365289 2:237450758-237450780 GGTGGTGATGCCCAGCCAGGTGG No data
948365285_948365295 21 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365295 2:237450779-237450801 GGGCACGGACCTCCCCACCCTGG No data
948365285_948365297 29 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365297 2:237450787-237450809 ACCTCCCCACCCTGGGTCTCAGG No data
948365285_948365296 22 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365296 2:237450780-237450802 GGCACGGACCTCCCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365285 Original CRISPR TCCCATGCAGCTTGTGTGCC AGG (reversed) Intergenic