ID: 948365290

View in Genome Browser
Species Human (GRCh38)
Location 2:237450759-237450781
Sequence GTGGTGATGCCCAGCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365281_948365290 6 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365280_948365290 14 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365282_948365290 5 Left 948365282 2:237450731-237450753 CCGGCCTGGCACACAAGCTGCAT No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365277_948365290 30 Left 948365277 2:237450706-237450728 CCAATGGTGCAAGGCGCCGGGCT No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data
948365285_948365290 1 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365290 Original CRISPR GTGGTGATGCCCAGCCAGGT GGG Intergenic