ID: 948365291

View in Genome Browser
Species Human (GRCh38)
Location 2:237450764-237450786
Sequence GATGCCCAGCCAGGTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948365282_948365291 10 Left 948365282 2:237450731-237450753 CCGGCCTGGCACACAAGCTGCAT No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365285_948365291 6 Left 948365285 2:237450735-237450757 CCTGGCACACAAGCTGCATGGGA No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365280_948365291 19 Left 948365280 2:237450722-237450744 CCGGGCTGCCCGGCCTGGCACAC No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data
948365281_948365291 11 Left 948365281 2:237450730-237450752 CCCGGCCTGGCACACAAGCTGCA No data
Right 948365291 2:237450764-237450786 GATGCCCAGCCAGGTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948365291 Original CRISPR GATGCCCAGCCAGGTGGGCA CGG Intergenic